КулЛиб - Скачать fb2 - Читать онлайн - Отзывы
Всего книг - 403291 томов
Объем библиотеки - 530 Гб.
Всего авторов - 171610
Пользователей - 91600
Загрузка...

Впечатления

kiyanyn про Тюдор: Спросите у северокорейца. Бывшие граждане о жизни внутри самой закрытой страны мира (Культурология)

Безотносительно к содержанию книги - где вы видели правдивые рассказы беглеца из страны? Ему надо устроиться на новом месте, и он расскажет все, что от него хотят услышать - если это поможет ему как-то устроиться.

Вспомнить, что рассказывали наши бывшие во времена СССР о жизни "за железным занавесом" - так КНДР будет казаться раем земным :)

Конкретную оценку не даю - еще не прочел.

Рейтинг: +1 ( 1 за, 0 против).
djvovan про Булавин: Лекарь (Фэнтези)

ужас

Рейтинг: +1 ( 1 за, 0 против).
nga_rang про Семух: S-T-I-K-S. Человек с собакой (Научная Фантастика)

Качественная книга о больном ублюдке. Читается с интересом и отвращением.

Рейтинг: -1 ( 2 за, 3 против).
Stribog73 про Лысков: Сталинские репрессии. «Черные мифы» и факты (История)

Опять книга заблокирована, но в некоторых других библиотеках она пока доступна.

По поводу репрессий могу рассказать на примере своих родственников.
Мой прадед, донской казак, был во время коллективизации раскулачен. Но не за лошадь и корову, а за то что вел активную пропаганду против колхозов. Его не расстреляли и не посадили, а выслали со всей семьей с Украины в Поволжье. В дороге он провалился в полынью, простудился и умер. Моя прабабушка осталась одна с 6 детьми. Как здорово ей жилось, мне трудно даже представить.
Старшая из ее дочерей была осуждена на 2 года лагерей за колоски. Пока она отбывала срок от голода умерла ее дочь.
Мой дед по материнской линии, белорус, тот самый дед, который после Халхин-Гола, где он получил тяжелейшее ранение в живот, и до начала ВОВ служил стрелком НКВД, тоже чуть-было не оказался в лагерях. Его исключили из партии и завели на него дело. Но суд его оправдал. Ему предложили опять вступить в партию, те самые люди, которые его исключали, на что он ответил: "Пока вы в этой партии - меня в ней не будет!" И, как не странно, это ему сошло с рук.
Другой мой дед, по отцу, тоже из крестьян (у меня все предки из крестьян), тоже был перед войной осужден, за то, что ляпнул что-то лишнее. Во время войны работал на покрытии снарядов, на цианидных ваннах.
Моя бабушка, по матери, в начале войны работала на железной дороге. Когда к городу, где она работала, подошли фашисты, она и ее сослуживицы получили приказ в первую очередь обеспечить вывоз секретной документации. В результате документацию они-то отправили, а сами оказались в оккупации. После того, как их город освободили, ими занялось НКВД. Но ни ее и никого из ее подруг не посадили. Но несмотря на это моя бабушка никому кроме родственников до конца жизни (а прожила она 82 года) не говорила, что была в оккупации - боялась.

Но самое удивительное в том, что никто из этих моих родственников никогда не обвинял в своих бедах Сталина, а наоборот - говорили о нем только с уважением, даже в годы Перестройки, когда дерьмо на Сталина лилось из каждого утюга!
Моя покойная мама как-то сказала о своем послевоенном детстве: "Мы жили бедно, но какие были замечательные люди! И мы видели, что партия во главе со Сталиным не жирует, не ворует и не чешет задницы, а работает на то, чтобы с каждым днем жизнь человека становилась лучше. И мы видели результат". А вот Хруща моя мама ненавидела не меньше, чем Горбача.
Вот такие вот дела.

Рейтинг: +4 ( 6 за, 2 против).
Stribog73 про Баррер: ОСТОРОЖНО, СПОРТ! О ВРЕДЕ БЕГА, ФИТНЕСА И ДРУГИХ ФИЗИЧЕСКИХ НАГРУЗОК (Здоровье)

Книга заблокирована, но она есть в других библиотеках.

Сын сослуживца моей мамы профессионально занимался бегом. Что это ему дало? Смерть в 30 лет от остановки сердца прямо на беговой дорожке. Что это дало окружающим? Родители остались без сына, жена - без мужа, а дети - без отца!
Моя сослуживеца в детстве занималась велоспортом. Что это ей дало? Варикоз, да такой, что в 35 лет ей пришлось сделать две операции. Что это дало окружающим? НИ-ЧЕ-ГО!
Один мой друг занимался тяжелой атлетикой. Что это ему дало? Гипертонию и повышенный риск умереть от инсульта. Что это дало окружающим? НИ-ЧЕ-ГО!
Я сам в молодости несколько лет занимался каратэ. Что это мне дало? Разбитые суставы, особенно колени, которые сейчас так иногда болят, что я с трудом дохожу до сортира. Что это дало окружающим? НИ-ЧЕ-ГО!

Дворник, который днем метет двор, а вечером выпивает бутылку водки вредит своему здоровью меньше, живет дольше, а пользы окружающим приносит гораздо больше, чем любой спортсмен (это не абстрактное высказывание, а наблюдение из жизни - этот самый дворник вполне реальный человек).

Рейтинг: +6 ( 6 за, 0 против).
Symbolic про Деев: Доблесть со свалки (СИ) (Боевая фантастика)

Очень даже не плохо. Вся книга написана в позитивном ключе, т.е. элементы триллера угадываются едва-едва, а вот приключения с положительным исходом здесь на первом месте. Фантастика для непринуждённого прочтения под хорошее настроение. Продолжение к этой книге не обязательно, всё закончилось хепи-эндом и на том спасибо.

Рейтинг: 0 ( 0 за, 0 против).
Stribog73 про Дроздов: Лейб-хирург (Альтернативная история)

2 ZYRA
Ты, ЗЫРЯ, как собственно и все фашисты везде и во все времена, большие мастера все переворачивать с ног на голову.
Ты тут цитируешь мои ответы на твои письма мне в личку? Хорошо! Я где нибудь процитирую твои письма мне - что ты мне там писал, как называл и с кем сравнивал. Особенно это будет интересно почитать ребятам казахской национальности. Только после этого я тебе не советую оказаться в Казахстане, даже проездом, и даже под охраной Службы безопасности Украины. Хотя сильно не сцы - казахи, в большинстве своем, ребята не злые и не жестокие. Сильно и долго бить не будут. Но от выражений вроде "овце*б-казах ускоглазый" отучат раз и на всегда.

Кстати, в Казахстане национализм не приветствовался никогда, не приветствуется и сейчас. В советские времена за это могли запросто набить морду - всем интернациональным населением.
А на месте города, который когда-то назывался Ленинск, а сейчас называется Байконур, раньше был хутор Болдино. В городе Байконур, совхозе Акай и поселке Тюра-Там казахи с украинскими фамилиями не такая уж редкость. Например, один мой школьный приятель - Слава Куценко.

Ты вот тут, ЗЫРЯ, и пара-тройка твоих соратников-фашистов минусуете все мои комментарии. Мне это по барабану, потому что я уверен, что на КулЛибе, да и во всем Рунете, нормальных людей по меньшей мере раз в 100 больше, чем фашистов. Причем, большинство фашистов стараются не афишировать свои взгляды, в отличии от тебя. Кстати, твой друг и партайгеноссе Гекк уже договорился - и на КулЛибе и на Флибусте.

Я в своей жизни сталкивался с представителями очень многих национальностей СССР, и только 5 человек из них были националисты: двое русских, один - украинский еврей, один - казах и один представитель одного из малых народов Кавказа, какого именно - не помню. Но все они, кроме одного, свой национализм не афишировали, а совсем наоборот. Пока трезвые - прямо паиньки.

Рейтинг: +3 ( 5 за, 2 против).
загрузка...

Приспособиться и выжить! (fb2)

- Приспособиться и выжить! (пер. Татьяна Петровна Мосолова) (и.с. Элементы) 12.73 Мб, 278с. (скачать fb2) - Шон Кэрролл

Настройки текста:



Шон Кэрролл Приспособиться и выжить! ДНК как летопись эволюции

Посвящается Джоан Г. Кэрролл и покойному Дж. Роберту Кэрроллу.

Спасибо за мою ДНК и все мои мутации.


Применение анализа ДНК в судебно-медицинской экспертизе. Семь вертикальных дорожек — это образцы ДНК семи подозреваемых. В центре нанесена ДНК, обнаруженная на месте преступления, которая, как мы видим, совпадает только с ДНК подозреваемого № 3. Печатается с разрешения лаборатории Cellmark Diagnostics.

Предисловие Вне всяких сомнений

Факты не перестают существовать оттого, что ими пренебрегают.

Олдос Хаксли

В 1979 году Диана Грин, находившаяся на последнем месяце беременности, была сильно избита, и ее нерожденный ребенок погиб от полученных травм. Женщина потеряла память и на судебном процессе не могла произнести даже собственное имя, но тем не менее подтвердила, что увечья ей нанес ее муж, Кевин Грин. Грин был обвинен в убийстве и в покушении на убийство.

В 1996 году сотрудники лаборатории Калифорнийского департамента юстиции вновь вернулись к этому делу, чтобы провести анализ ДНК. Анализируя образец ДНК с места преступления и ДНК Грина, исследователи обнаружили, что ДНК с места преступления 17-летней давности, а также ДНК, обнаруженная в ходе расследования четырех других убийств, совпадала с ДНК другого мужчины, Джеральда Паркера, который в это время находился в тюрьме за несоблюдение условий досрочного освобождения из предыдущего заключения. Когда Паркеру предъявили результаты анализа ДНК, он сознался в своих преступлениях (и впоследствии был приговорен к смерти), а Грин вышел на свободу, отсидев в тюрьме 16 лет за преступление, которого не совершал.

Анализ ДНК является гораздо более точным и строгим методом, чем анализ волос или отпечатков пальцев, и гораздо более надежным, чем показания свидетелей, и поэтому он может служить окончательным доказательством того, что кто-то находился (или не находился) на месте преступления. Бесспорность генетических доказательств во множестве судебных дел, аналогичных делу Грина, привела к революционным преобразованиям в криминалистике и к широкому привлечению генетического анализа к доказательству виновности и подтверждению невиновности подозреваемых. Многие преступления, которые в прошлом остались бы нераскрытыми, а также многие дела, безнадежно висевшие десятки лет, теперь раскрываются в рутинном порядке. Растет и число оправдательных приговоров. Американская организация «Проект невиновности» (Innocence Project), занимающаяся оправданием осужденных с помощью анализа генетического материала, сообщает, что за последние 13 лет было освобождено свыше 150 человек, причем некоторые из них вышли из камеры смертников.

Анализ ДНК применяется не только в криминалистике. Теперь не представляет особой трудности определение отцовства, а также выявление генетической предрасположенности к определенным заболеваниям. Однако осталась еще одна область, где возможности генетических методов оценены не до конца: эта область в некотором роде относится к сфере философии.

Дело в том, что уникальной является не только ДНК каждого индивида — уникальна и ДНК каждого вида организмов. Любое эволюционное различие между видами (от внешних признаков до особенностей обмена веществ) связано с изменением ДНК и отражено в ДНК. Таким образом, «устанавливать отцовство» можно не только на уровне отдельных индивидов, но и на уровне видов организмов. Можно сказать, что ДНК содержит в себе экспертный отчет о ходе эволюции.

Тут следует отметить одно довольно забавное обстоятельство. Присяжные и судьи опираются на генетические доказательства в вопросах, касающихся жизни и смерти тысяч людей. И кажется, 100 % населения США поддерживают эту практику. Но при этом около половины американцев до сих пор не верят в теорию биологической эволюции. Совершенно очевидно, что мы гораздо лучше справляемся с применением ДНК, чем с объяснением ее сути.

Более 100 лет назад Уильям Бэтсон[1] начал свою книгу, ставшую одним из важнейших трудов по эволюции после трудов Дарвина, такими словами: «Если фактов старого типа недостаточно, давайте займемся поиском фактов нового типа. Я верю, что многие натуралисты начинают осознавать, что пришло время отправиться в новый путь».


Сейчас, когда анализ ДНК проникает в самые разные области нашей жизни, настало время опять отправиться в путь за фактами нового типа. В этой книге я поставил перед собой задачу представить читателю новые факты об эволюции, обнаруженные благодаря анализу ДНК. В последние годы биологи получили доступ к гигантскому объему генетической информации, касающейся многих видов организмов, включая человека и его ближайших родственников. Всего за 20 лет количество последовательностей в генетических базах данных выросло в 40 тыс. раз, причем большая часть этой информации получена уже в новом тысячелетии. Представьте себе, что в 1982 г. наши знания о последовательностях ДНК всех организмов в целом не превышали миллиона знаков. Напечатав эти знаки в виде букв и строчек, мы получили бы книгу примерно такого же размера, как та, что вы сейчас держите в руках. Если же напечатать в виде книг все последовательности ДНК, известные нам сегодня, и сложить их стопкой, эта башня вдвое превысит высоту 110-этажного небоскреба Сирс-тауэр в Чикаго. И это собрание информации о жизни продолжает расти в высоту более чем на 30 этажей в год.

Внутри этих книг — последовательность ДНК, лежащая в основе строения всех видов бактерий, грибов, растений и животных. Расшифровка этих текстов, состоящих из практически бесконечного набора перестановок всего четырех букв (A, C, G и T), открывает нам самые широкие возможности за всю историю эволюционной биологии. Биологи анализируют этот новый, богатейший источник информации, чтобы изучить и понять наиболее загадочные события в естественной истории и установить в мельчайших подробностях, ранее недоступных, как в ходе эволюции формировались все важнейшие признаки. В этой книге я расскажу о том, каким образом новая наука под названием геномика — полное и, что более важно, сравнительное исследование ДНК разных видов организмов — принципиальным образом расширяет и углубляет наши знания об эволюции жизни.

Геномика позволяет нам глубоко проникнуть в суть эволюционного процесса. Со времен Дарвина прошло более 100 лет, но все это время наблюдать за ходом естественного отбора ученые по-прежнему могли только на уровне целых организмов (таких как вьюрки или бабочки) по различиям в их выживаемости или репродукции. Теперь мы можем увидеть, как сделаны наиболее приспособленные. ДНК содержит абсолютно новый тип информации, о котором Дарвин не подозревал и не мог даже мечтать, но который окончательно подтверждает его теорию эволюции. Теперь мы можем идентифицировать те специфические изменения ДНК, которые позволили видам адаптироваться к меняющимся условиям существования и к новому образу жизни.

Этот новый уровень понимания не просто обеспечивает нас окончательными доказательствами, он преподносит и некоторые сюрпризы, которые расширяют наш взгляд на эволюцию. Например, в ДНК любого вида мы находим «ископаемые» гены. Это фрагменты ДНК, которые нужны были предкам современных организмов, но со временем вышли из употребления и начали разрушаться. Эти реликтовые участки ДНК — абсолютно новый источник информации о тех признаках и способностях живых организмов, которые исчезли при изменении образа жизни.

Кроме того, летопись ДНК показывает, что эволюция может повторять — и повторяет — саму себя. Похожие или идентичные адаптационные изменения происходили одинаковым образом у столь разных организмов, как, например, бабочки и люди. Это говорит о том, что при возникновении одних и тех же трудностей или возможностей в самые разные моменты времени и в самых разных местах развитие жизни может пойти по одному и тому же пути. Эта повторяемость и воспроизводимость опровергает бытующее мнение о том, что, если бы ход истории живых организмов можно было переиграть заново, мир был бы совсем другим.

Анализ ДНК произвел революцию и в изучении происхождения человека и возникновения человеческой цивилизации. Хотя внимание журналистов было приковано в основном к прочтению генома человека, понять значение этого текста можно только по мере расшифровки генов и геномов других приматов и млекопитающих. Наши гены свидетельствуют о том, чем мы отличаемся от других и как мы такими стали. Многие гены несут на себе шрамы естественного отбора — тех битв, которые наши предки вели с микробами на протяжении многих тысячелетий.

Когда я писал эту книгу, я имел в виду самых разных читателей. Тем, кто интересуется естественной историей, я предложу путешествие по планете и расскажу о множестве удивительных существ, приспособившихся к жизни в горячих источниках, пещерах, джунглях, магматических отложениях, в глубинах океана и прочих необычных местах. Есть некое величие в этом новом знании о том, как замена одного или нескольких знаков простого кода серьезнейшим образом изменяет форму или физиологию сложных организмов. Для студентов и преподавателей я выбрал, на мой взгляд, наиболее интересные примеры, иллюстрирующие ключевые этапы эволюции и усиливающие наше благоговение перед замечательным разнообразием и изменчивостью жизни. Большинство историй, которые я расскажу, еще не попали в учебники, но многие из них станут неотъемлемой частью эволюционной науки. Тем, кто пытается пробраться сквозь риторику и псевдонаучные измышления противников эволюционного учения, я помогу разобраться в тактике и аргументации, при помощи которой они ставят под сомнение эволюцию, и предложу достаточно научных доказательств, чтобы разбить эту аргументацию в пух и прах.

Новые данные о строении ДНК играют важную роль не только в объяснении эволюционного процесса. Они могут сыграть решающую роль в продолжающейся борьбе за то, как преподавать теорию эволюции в школах, и в восприятии эволюционных идей обществом в целом. Лично мне кажется абсолютно ненормальным, что присяжные полагаются на данные о генетической вариабельности людей и анализ ДНК, решая вопросы о свободе и жизни подозреваемых, но при этом школьные учителя не преподают тех принципов, на которых основаны эти доказательства, да и вообще вся биология. Отрицание эволюции базируется на совершенно ложных представлениях о генетике и эволюционных механизмах. Те новые доказательства, о которых я расскажу в книге, не оставляют места для сомнений в том, что биологическая эволюция является основой разнообразия жизни на Земле.

Остров Буве, сфотографированный Дитлефом Рустадом в 1928 г во время экспедиции на судне «Норвегия». Из отчета Норвежской антарктической экспедиции за 1927–1928 гг. (I. Kommisjon Hos Jacob Dybwad of Oslo, 1935).

Глава 1 Введение. Белокровная рыба с острова Буве

Когда мы перестанем смотреть на органическое существо, как дикарь смотрит на корабль, то есть как на нечто превышающее его понимание; когда в каждом произведении природы мы будем видеть нечто имеющее длинную историю; когда в каждом сложном строении или инстинкте мы будем видеть итог многочисленных приспособлений, каждое из которых полезно их обладателю, подобно тому как всякое великое механическое изобретение есть итог труда, опытности, разума и даже ошибок многочисленных тружеников; когда мы выработаем такое воззрение на органические существа — как неизмеримо (говорю на основании личного опыта) возрастет интерес, который представит нам изучение естественной истории![2]

Чарльз Дарвин «О происхождении видов» (1859)

Возможно, это самый одинокий уголок земли в бескрайнем океане.

Крохотный островок Буве — маленькое пятнышко в широких просторах Южной Атлантики. Он расположен в 2 тыс. км к юго-западу от мыса Доброй Надежды (Африка) и почти в 4 тыс. км на восток от мыса Горн (Южная Америка) (рис. 1.1). Великий капитан Джеймс Кук на судне «Резолюшн» дважды безуспешно пытался найти этот остров во время плавания по Южным морям в 1770-х гг. Остров покрыт толстенным слоем льда, заканчивающимся отвесными скалами, которые обрываются у черных вулканических берегов. Люди и сейчас не очень часто посещают этот остров, где среднегодовая температура воздуха ниже температуры замерзания воды.

Рис. 1.1. Карта южной части Атлантического океана. Рисунок Лианн Олдс.


К счастью для естественной истории и для моего рассказа, норвежское исследовательское судно «Норвегия» побывало на острове Буве в 1928 г. Высадка на берег нужна была, чтобы обустроить укрытие и оставить запас провианта для моряков на случай кораблекрушений. Во время стоянки корабельный биолог Дитлеф Рустад, тогда еще студент, изучавший зоологию, поймал несколько забавных рыб. Они во многом напоминали обычных рыб — у них были большие глаза, крупные грудные и хвостовые плавники и длинная, полная зубов выпяченная челюсть. Но они были невероятно бледными, практически прозрачными (рис. 1.2; рис. A и B цветной вкладки).

Рис. 1.2. Ледяная, или белокровная, рыба. Фотография любезно предоставлена Итальянской антарктической программой PNRA.

При более внимательном изучении этих странных животных, которых Рустад назвал «белыми крокодиловыми рыбами», выяснилось, что кровь у них совершенно бесцветная.


Через два года Йохан Рууд, однокурсник Рустада, отправился в Антарктику на китобойном судне «Викинг». Когда один из членов экипажа, занимавшийся добычей ворвани, спросил его: «А ты знаешь, что тут встречаются рыбы, у которых нет крови?», Рууд подумал, что тот просто подшучивает над ним. Он решил подыграть и ответил: «Неужели? Прихвати для меня парочку, пожалуйста!»

Рууд хорошо знал физиологию животных и был абсолютно уверен в том, что бескровных рыб быть не должно: во всех учебниках однозначно утверждалось, что все позвоночные (рыбы, земноводные, рептилии, птицы и млекопитающие) содержат в крови красные кровяные клетки, в которых, в свою очередь, содержится необходимый для дыхания окрашенный гемоглобин. Это так же очевидно, как то, что все дышат кислородом. Поэтому, когда китобои вернулись на борт, не привезя с собой ни одной blodlaus-fisk (бескровной рыбы), Рууд выбросил этот эпизод из головы, сочтя его элементом морского фольклора.

Через год он вернулся в Норвегию и рассказал эту историю Рустаду. К его невероятному изумлению, Рустад сообщил, что видел такую рыбу, и показал ему фотографии, которые сделал во время экспедиции.

Около 20 лет Рууд ничего не слышал о белокровных рыбах. Но потом другой норвежский биолог вернулся из антарктической экспедиции, привезя с собой белокровную рыбу из других мест. Любопытство вновь охватило Рууда, и он стал просить своих коллег, работавших в Антарктике, обращать внимание на рыбу, которую китобои называли «дьявольской рыбой» или просто «ледяной», поскольку ее тело было практически прозрачным. Наконец, в 1953 г., почти через 25 лет после своего первого путешествия, Рууд сам вернулся в Антарктику в надежде поймать и изучить этих странных рыб и разгадать тайну их крови.

Рууд организовал самодельную лабораторию на острове Южная Георгия (именно сюда прибыл в 1916 г. исследователь Антарктики Эрнест Шеклтон, спасая команду зажатого во льдах судна «Эндуранс»). Он сразу раздобыл несколько ценных экземпляров рыб и принялся анализировать их странную кровь. Результаты его исследований, опубликованные в 1954 г., по-прежнему вызывают шок у любого биолога, видящего их в первый раз. У этих рыб вообще не было переносящих кислород красных кровяных клеток, которые до открытия этих странных антарктических существ находили у каждого позвоночного животного. И до сих пор ученые не знают других примеров белокровных позвоночных, за исключением известных на сегодняшний день примерно 15 видов ледяных рыб.

В красных кровяных клетках (эритроцитах) содержится много молекул гемоглобина, которые связывают кислород в легких или жабрах, а затем высвобождают его в других участках тела в процессе циркуляции крови. Молекула гемоглобина состоит из белка глобина и небольшой молекулы, называемой гемом. Красный цвет крови связан именно с наличием гема, встроенного в гемоглобин и связывающего кислород. Если бы у нас не было эритроцитов, мы бы умерли (и умираем: патологическое состояние, связанное с низким уровнем содержания эритроцитов, называется анемией). Даже у близких родственников ледяных рыб, таких как антарктический каменный окунь и новозеландская масляная рыба, кровь красная.

Обнаружение столь удивительных рыб вызвало множество вопросов. Где, когда и как они появились? Что произошло с их гемоглобином? Как могут эти рыбы обходиться без эритроцитов?

Часто о происхождении вида можно судить по ископаемым останкам, однако подобных источников информации в случае ледяной рыбы и ее родственников не обнаружено. Но даже если бы мы и нашли такие останки, то на их основании мы не смогли бы определить, какого цвета кровь была у этих животных и когда она изменилась. К счастью, у нас есть другой источник информации об истории эволюции ледяной рыбы — ее ДНК.

Ясный и совершенно ошеломляющий ответ на вопрос о том, что случилось с гемоглобином ледяной рыбы, был получен через 40 с лишним лет после того, как Рууд взял образцы их крови. У этих удивительных рыб перестали работать два гена, которые у всех остальных позвоночных кодируют белок глобин. Один из этих двух генов превратился в «молекулярное ископаемое»: он по-прежнему присутствует в ДНК ледяной рыбы, но стал ненужным и частично разрушился, подобно тому как окаменелости рассыпаются под влиянием внешней среды. Второй ген глобина, который в ДНК обычных рыб находится непосредственно рядом с первым, полностью исчез. Таким образом, ледяная рыба навсегда лишилась генов для синтеза молекулы, которая на протяжении 500 млн лет поддерживала жизнь ее предшественников.

Что стало причиной отказа от средства поддержания жизни, которым пользуются все другие позвоночные животные на нашей планете?

Необходимость и возможность, вызванные серьезными и длительными изменениями температуры океана и подводных течений.

Около 55 млн лет назад температура воды в Южном Океане упала от примерно +20 до -1 °C в некоторых районах. Примерно 33–34 млн лет назад в результате движения тектонических плит Антарктида отделилась от южной оконечности Южной Америки и оказалась окружена океаном со всех сторон. Последовавшее за этим изменение морских течений изолировало воды, окружающие Антарктиду, так что они перестали перемешиваться с водами других районов океана. Рыбы вынуждены были либо адаптироваться к подобным переменам, либо вымереть (именно эта судьба постигла большинство видов). В то время как все остальные исчезли, одна группа рыб сумела извлечь выгоду из новых условий обитания. Ледяные рыбы — это небольшое семейство, относящееся к более обширному подотряду нототениевых рыб, который, включает в себя около 200 видов и сегодня доминирует в водах антарктического региона.

Низкая температура воды в Антарктике представляет собой серьезную проблему для функционирования организма. Как масло в моем автомобиле зимой в Висконсине, жидкости организма при температуре замерзания воды становятся очень вязкими, что затрудняет их циркуляцию. Антарктические рыбы вышли из положения, снизив содержание эритроцитов в циркулирующей крови. Гематокрит (доля эритроцитов во всем объеме крови) обычных антарктических рыб составляет от 15 до 18 %, тогда как у нас с вами гематокрит находится на уровне 45 %. Однако у ледяной рыбы этот процесс пошел еще дальше, и эритроциты были удалены из крови полностью, а гены гемоглобина за ненадобностью разрушились под грузом мутаций. Кровь ледяной рыбы настолько разбавлена, что содержит лишь 1 % клеток (исключительно белых клеток крови), так что можно сказать, что в их жилах течет вместо крови ледяная вода! Как же эти существа обходятся без необходимого для жизни гемоглобина?

Теперь понятно, что потеря гемоглобина сопровождалась целой серией изменений, которые позволили ледяной рыбе прекрасно чувствовать себя при отрицательной температуре. Одно из важных различий между теплой и холодной водой заключается в том, что в холодной воде кислород растворяется гораздо лучше, чем в теплой. Ледяные воды океана чрезвычайно богаты кислородом. У ледяной рыбы довольно крупные жабры и кожа без чешуи, но с очень толстыми капиллярами. Эти две особенности повышают ее способность поглощать кислород из воды. Кроме того, у ледяной рыбы более крупное сердце и больше объем крови, чем у ее родственников, обладающих красной кровью.

Сердце ледяной рыбы имеет и еще одну принципиальную особенность — оно зачастую очень бледное. Розовый цвет сердец (и скелетных мышц) позвоночных животных связан с присутствием другой молекулы, содержащей гем и связывающей кислород, которая называется миоглобином. Миоглобин связывает кислород более прочно, чем гемоглобин, и запасает его в мышцах, откуда кислород высвобождается при физической нагрузке. В мышцах китов, тюленей и дельфинов так много миоглобина, что эти мышцы коричневого цвета. Высокое содержание миоглобина позволяет этим животным долгое время находиться под водой. Однако в организме ледяных рыб миоглобин не заменяет гемоглобин. Он, как и гемоглобин, отсутствует в мышцах всех ледяных рыб и в сердцах у пяти их видов (поэтому они такие бледные). У позвоночных животных белок миоглобин кодируется одним-единственным геном. Анализ ДНК ледяных рыб с бледным сердцем показал, что их ген миоглобина мутирован: в него встроено пять дополнительных оснований ДНК, что нарушило код, необходимый для синтеза нормального миоглобина. У этих видов ген миоглобина тоже начал превращаться в ископаемый ген. Изменения в сердечно-сосудистой системе ледяной рыбы позволяют ей получать и доставлять к тканям необходимое количество кислорода без участия двух главных молекулярных переносчиков кислорода.

Жизнь в очень холодной воде потребовала от рыб и других изменений — бесспорные тому свидетельства обнаружены на многих участках их генома. Чтобы приспособиться к жизни в холоде, должны измениться даже основные внутриклеточные структуры. Например, основной каркас, или «скелет», клеток образован микротрубочками. Эти структуры участвуют в делении и перемещении клеток, а также определяют их форму. Белки, образующие микротрубочки, выполняют в клетках так много важных функций, что почти без изменений сохранились не только у всех позвоночных, но у всех эукариот (к которым среди прочих организмов относятся животные, растения и грибы). При температуре ниже 0 °C микротрубочки в клетках млекопитающих становятся нестабильными. Если бы это происходило у антарктических рыб, они бы давно вымерли. Но у них, напротив, микротрубочки собираются в стабильные структуры как раз при отрицательной температуре. Это замечательное свойство микротрубочек связано с серией изменений в генах, кодирующих компоненты микротрубочек, и эти изменения произошли лишь у рыб, обитающих в холодной воде (не только у ледяных, но и у их родственников, обладающих красной кровью).

Изменения произошли и во многих других генах, что позволило всем физиологическим процессам протекать при отрицательной температуре. Однако адаптация к холоду не ограничилась модификацией одних генов и исчезновением других; потребовались и некоторые нововведения. Прежде всего следует рассказать о появлении «белков-антифризов». В плазме антарктических рыб очень много этих необычных белков, которые помогают рыбам жить в ледяной воде, снижая пороговое значение температуры образования ледяных кристаллов. Не будь этих белков, рыба полностью заморозилась бы. Структура у них очень необычная и очень простая. Они состоят из последовательностей всего трех аминокислот, которые повторяются от 4 до 55 раз, тогда как большинство белков построены из 20 типов аминокислотных остатков. У обитателей теплых морей нет похожих белков, и это означает, что «белки-антифризы» в какой-то момент были «изобретены» антарктическими рыбами. Как же они возникли?

Кристина Чхен, Артур де Фрис и их коллеги из Университета Иллинойса обнаружили, что гены этих странных белков образовались из части другого, совершенно не родственного гена. Этот исходный ген кодировал пищеварительный фермент. Небольшой фрагмент этого гена выделился из последовательности и встроился в другое место в геноме ледяных рыб. Из этого фрагмента, состоящего всего из девяти нуклеотидов, образовался новый ген, кодирующий «белок-антифриз». Происхождение «белков-антифризов» является прекрасным примером того, что эволюция чаще всего идет по пути использования уже имеющегося материала (в данном случае небольшого фрагмента другого гена), чем по пути изобретения чего-то абсолютно нового.

Как житель холодного региона я восхищаюсь изобретательностью и мужеством ледяных рыб. Нам в Висконсине приходится использовать всякие ухищрения, чтобы заставить наши автомобили двигаться при отрицательной температуре, в то время как ледяные рыбы ухитрились полностью заменить всю рабочую систему, не останавливая двигатель. Они изобрели новый антифриз, заменили обычное масло (кровь) на масло с чрезвычайно низкой вязкостью, расширили топливный насос (сердце) и отбросили некоторые лишние детали — те, которыми были оснащены все «модели» рыб на протяжении 500 млн лет.

Информация, заключенная в ДНК ледяной рыбы, а также любого другого вида, представляет собой совершенно новый источник данных о ходе эволюционного процесса. Эта информация позволяет нам видеть больше, чем просто кости и кровь, она позволяет напрямую заглянуть в тексты, записанные в ходе эволюции. Создание такого удивительного существа, каким является ледяная рыба, на уровне ДНК выглядит как обычный, в некоторой степени случайный процесс формирования более приспособленного вида. Ледяная рыба возникла из обычной рыбы с красной кровью, которая была плохо приспособлена к жизни в холодной воде. Адаптация ледяной рыбы к изменяющимся условиям существования в Южном океане не была мгновенным изобретением, как не была она результатом направленного «прогрессивного» процесса. Это была импровизированная серия многочисленных изменений, в числе которых изобретение нового гена, разрушение старого и модификация многих других.

Сравнивая гены различных видов ледяных рыб с генами их ближайших родственников с красной кровью, а также с генами других антарктических рыб, мы можем увидеть изменения, происходившие на разных этапах эволюции ледяной рыбы. Все 200 видов антарктических рыб, относящихся к семейству нототениевых, имеют гены «белков-антифризов», что означает, что это давнее приобретение. Также у всех этих рыб модифицированы гены микротрубочек. Однако лишь примерно у 15 видов ледяных рыб имеются «ископаемые» гены гемоглобина. Это означает, что гены гемоглобина перестали работать примерно в то же время, когда появились ледяные рыбы. Более того, некоторые ледяные рыбы не имеют миоглобина, но другие его по-прежнему синтезируют. То есть изменения в генах миоглобина произошли позднее, чем возникли ледяные рыбы, и процесс использования (или неиспользования) миоглобина продолжает эволюционировать. Сравнивая другие последовательности ДНК, можно построить график этих событий на фоне изменений климата в Южной Атлантике, который показывает, что антарктические нототении возникли 25 млн лет назад, а ледяные рыбы — лишь 8 млн лет назад (рис. 1.3). Анализ ДНК показывает, что ледяная рыба «перешла границу» между жизнью в теплой воде и зависимостью от гемоглобина к жизни в очень холодной воде и отказу от гемоглобина (а иногда и миоглобина) не за один скачок, а в результате многостадийного процесса.

Рис. 1.3. Временная шкала эволюции ледяных рыб. Движение земной коры в Южном полушарии около 50 млн лет назад привело к значительным изменениям подводных течений и температуры (верхняя часть рисунка). Одна большая группа рыб, называемых нототениевыми рыбами, адаптировалась к жизни при низкой температуре: у них появились «белки-антифризы», холодоустойчивые тубулины, и понизился гематокрит. Позднее у общего предшественника всех ледяных рыб гены глобина перестали работать и перешли в «ископаемое» состояние. Рисунок Лианн Олдс.


Зафиксированные на уровне ДНК многочисленные модификации, произошедшие в организме ледяных рыб при их отделении от теплолюбивого древнего предшественника с красной кровью, наглядно демонстрируют два главных принципа эволюции — естественный отбор и наследование с изменениями. Впервые эти принципы были провозглашены за 100 лет до Рустада и Рууда другим зоологом, Чарльзом Дарвином. Чтобы я мог в полном объеме продемонстрировать вам значение заключенной в ДНК информации, важно вспомнить эти два принципа и их первую формулировку в книге «О происхождении видов».

Возвращаемся к Дарвину

Дарвин взошел на борт военного английского корабля «Бигль» в декабре 1831 г., в возрасте 22 лет. Это было началом пятилетнего кругосветного путешествия. Основное время корабль провел в районе Южной Америки, где неугомонный капитан Роберт Фицрой зарисовывал и перерисовывал все реки и гавани. Для Дарвина знакомство с животными, растениями, ископаемыми остатками и геологическими породами этого огромного континента стало началом большого пути, который через 20 с лишним лет привел к созданию трактата «О происхождении видов». Труд этот начинается такими словами:

Путешествуя на корабле Ее Величества «Бигль» в качестве натуралиста, я был поражен некоторыми фактами, касавшимися распространения органических существ в Южной Америке, и геологических отношений между прежними и современными обитателями этого континента. Факты эти, как будет видно из последующих глав этой книги, кажется, освещают до некоторой степени происхождение видов — эту тайну из тайн, по словам одного из наших величайших философов. По возвращении домой я в 1837 году пришел к мысли, что, может быть, что-либо можно сделать для разрешения этого вопроса путем терпеливого собирания и обдумывания всякого рода фактов, имеющих какое-нибудь к нему отношение. После пяти лет труда я позволил себе некоторые общие соображения по этому предмету и набросал их в виде кратких заметок; этот набросок я расширил в 1844 году в общий очерк тех заключений, которые тогда представлялись мне вероятными; с того времени и до настоящего дня я упорно занимался этим предметом. Я надеюсь, мне простят эти чисто личные подробности, так как я привожу их затем только, чтобы показать, что не был поспешен в своих выводах.

Эти «краткие записи» заняли 502 страницы и были распроданы за один день — 24 ноября 1859 г.

«До чего же глупо было не додуматься до этого!» — воскликнул знаменитый биолог Томас Хаксли, прочтя книгу Дарвина «О происхождении видов».

Вопреки распространенному мнению, Дарвин не был автором идеи эволюционного развития. Эта идея существовала уже на протяжении нескольких десятилетий, в том числе она была признана в семье самого Дарвина. Его дед, Эразм Дарвин, изложил теорию эволюции в своей книге «Зоономия, или законы органической жизни» (Zoonomia, or the Laws of Organic Life, 1794 г.).

Вовсе не сама идея изменяемости видов так потрясла Хаксли. Произведенное впечатление объяснялось мощью и одновременно интуитивной простотой двух идей, заключавшихся в «наследовании с изменениями» и «естественном отборе», которые предлагались в качестве механизма эволюции живых организмов.

Дарвин провел аналогию между отбором вариантов в процессе одомашнивания животных и борьбой за существование среди слишком многочисленного потомства диких животных:

Можно ли… считать невероятным, чтобы другие изменения, полезные в каком-нибудь смысле для существ в их великой и сложной жизненной битве, появлялись в длинном ряде последовательных поколений? Но если такие изменения появляются, то можем ли мы (помня, что родится гораздо более особей, чем может выжить) сомневаться в том, что особи, обладающие хотя бы самым незначительным преимуществом перед остальными, будут иметь более шансов на выживание и продолжение своего рода? С другой стороны, мы можем быть уверены, что всякое изменение, сколько-нибудь вредное, будет неукоснительно подвергаться истреблению. Сохранение благоприятных индивидуальных различий или изменений и уничтожение вредных я назвал «естественным отбором» [курсив Ш. К.].

«О происхождении видов», глава IV

И затем Дарвин приходит к смелому выводу о том, что этот процесс привел к возникновению всех современных форм жизни от общих предшественников:

Различные группы фактов… по-моему, столь ясно указывают, что бесчисленные виды, роды и семейства, населяющие земной шар, произошли каждый в пределах своего класса или группы от общих прародителей и затем изменялись в течение последовательного развития…

Там же, глава XIII[3]

А дальше еще смелее:

…а если мы допустим это, мы должны допустить, что и все органические существа, когда-либо жившие на земле, могли произойти от одной первобытной формы.

Там же, глава XIII[4]

Вот в чем заключается суть дарвиновской теории эволюции: естественный отбор мельчайших вариаций создал величайшее разнообразие форм жизни, начав с просто устроенного общего предка. Простая логика, научное бессмертие. Неудивительно, что Хаксли так себя ругал.

Однако в книге Дарвина есть нечто большее, чем эти несколько заключений (к некоторым из которых независимым образом пришел также Альфред Рассел Уоллес[5] в результате своих исследований в Южной Америке и на Малайском архипелаге). Дарвин представил доказательства. Его труд — это горы и горы наблюдений и фактов, изобретательные эксперименты, умные аналогии и 20 лет подбора профессиональной аргументации.

Мы, биологи, благодарны Дарвину за многое. Безусловно, книга «О происхождении видов» является самой главной книгой в биологии. «Длинный аргумент»[6] Дарвина превосходно построен, подтвержден великолепным набором фактов и представляет собой пример героического труда, выполненного одним человеком. Эту книгу до сих пор очень легко читать, и в ней по-прежнему чувствуется страсть автора. Однако наследие Дарвина состоит из множества книг, посвященных образованию коралловых рифов, важности полового отбора, биологии орхидей и усоногих раков и многому другому. Это пример того, как многого могут достичь в жизни талантливые и трудолюбивые люди.

Но почему же великие идеи Дарвина встретили такое сопротивление?

Покажите нам этапы эволюции

Сам Дарвин очень хорошо понимал и предвидел многие вопросы и возражения, которыми могло быть встречено появление его теории. В большинстве своем нападки на его идеи, конечно же, шли со стороны людей, которые считали его взгляды на историю жизни отталкивающими и унизительными без всякой научной подоплеки. Большинство ученых быстро восприняли идею эволюции, то есть идею об изменчивости видов. Но даже сторонникам Дарвина было трудно воспринять предложенный им механизм того, как эти изменения происходят.

Задуматься над механизмом было вполне резонно. Я полагаю, что многие ученым и простым людям поначалу стоит немалого труда свыкнуться с дарвиновским видением естественного отбора, известного также как идея о «выживании наиболее приспособленного». Заметим, кстати, что эту знаменитую формулировку придумал не Дарвин, а философ Герберт Спенсер. Это выражение по совету Уоллеса появилось только в пятом издании книги Дарвина, вышедшем в 1869 г. Процесс эволюции по Дарвину основывался на трех главных элементах: изменчивость, отбор и время. Каждый из них требовал объяснения и доказательства, и каждый мог вызывать недоверие. По существу, Дарвин просил своих читателей представить себе, как слабые изменения (причина которых была неизвестна и невидима) могут отбираться (в ходе невидимого процесса, который нельзя было измерить) и накапливаться на протяжении такого периода времени, который лежит за пределами человеческого опыта. Дарвин эту трудность понимал:

Главной причиной естественного нежелания допустить, что какой-либо вид дал начало другому, не сходному с ним виду, заключается в том, что мы всегда неохотно допускаем существование великих перемен, отдельных стадий которых мы не в состоянии уловить [курсив Ш. К.]. Это затруднение совершенно сходно с тем, которое испытывали геологи, когда Лайель[7] выдвинул впервые свое утверждение о том, что длинные ряды внутриматериковых скал и глубокие долины являются результатами деятельности факторов, которые мы и теперь еще видим в действии. Наш разум не может схватить полного смысла, связанного с выражением «миллион лет»; он не может подвести итог и усмотреть конечный результат многочисленных легких изменений, накоплявшихся в течение почти безграничного числа поколений.

«О происхождении видов», глава XIV[8]

Известный биолог и писатель Ричард Докинз указывает, что концепция естественного отбора обманчиво проста: «Как будто человеческий мозг специально создан таким образом, чтобы неправильно понимать теорию Дарвина и не верить в нее». Роль факторов случайности (в создании новых вариантов) и отбора (в наследовании признаков) очень легко понять неправильно. Роль случая часто очень сильно преувеличивают (иногда противники теории эволюции делают это умышленно), чтобы показать, что эволюция имеет совершенно случайный характер и что упорядоченность и усложнение — также результат случайности. Но это абсолютно неверно. Отбор, который не является случайным, определяет, какие из случайных вариаций будут сохранены. Только накапливающий отбор («сложение» в терминах Дарвина) вариаций приводит к усложнению и разнообразию, причем за такой период времени, который мы, люди, едва ли можем вообразить. Идея естественного отбора смущала даже сторонников Дарвина. Люди с трудом могут поверить в то, что отбор является настолько мощным механизмом, что способен распознавать и накапливать слабые изменения.

Лишь спустя примерно 50 лет после появления книги «О происхождении видов» биологи смогли разобраться во взаимодействии факторов вероятности, отбора и времени. Интересно, что окончательно убедиться в том, что естественный отбор, по крайней мере в теории, представляет собой достаточно мощный и быстрый механизм, способный направлять ход эволюции, биологам (даже самым сомневающимся) помогла математика — та самая «бытовая» математика, которая позволяет нам рассчитывать вероятность выигрыша в казино или в лотерее, а также оценивать прибыльность банковских вкладов.

Но математика работает лишь до определенного предела. Вспомните историю о Йохане Рууде и бескровной антарктической рыбе: многие из нас готовы поверить и понять, только если увидят собственными глазами. Мы хотим видеть, как работает эволюционный процесс. Мы хотим иметь возможность видеть, измерять и отслеживать этапы, пройденные эволюцией на пути от одного вида к другому.

И вот теперь, спустя 140 лет, мы можем это сделать.

Следы эволюции в ДНК

Теперь мы знаем, что каждый шаг эволюции учтен и записан в ДНК. Каждое изменение или новый признак — от антифриза белокровных антарктических рыб до изумительных оттенков альпийских цветов и наших крупных, наполненных мозгом черепов — является результатом одного или многих (иногда очень, очень многих) постепенных изменений в ДНК, которые мы теперь имеем возможность обнаружить. Некоторые из этих изменений малюсенькие — всего лишь замена одного основания ДНК в одном гене. Другие гораздо серьезнее и связаны с появлением (или потерей) целых генов или групп генов.

Мы получили возможность проследить за этими изменениями благодаря недавнему прорыву в наших знаниях о генах различных видов организмов и их геномах (полном наборе ДНК организма). Всего лишь несколько лет назад ученые расшифровали простые геномы бактерий и дрожжей, и вот уже одно за другим стремительно появляются сообщения о прочтении геномов таких сложных организмов, как шимпанзе, собаки, киты и различные растения. Уникальная последовательность ДНК каждого организма содержит полную информацию о нем нынешнем. Это перечень всех генов, необходимых для его создания и функционирования.

Но текст ДНК — это еще и окошко в близкое и далекое прошлое. Определение генома первого представителя какой-либо группы организмов прокладывает путь для гораздо более быстрого анализа геномов его родственников. Сравнивая гены и геномы организмов с разной степенью родства, мы можем обнаружить важные различия и найти следы естественного отбора. Кому-то эта картина поубавит спеси, а кого-то восхитит. Мы можем вернуться на несколько миллионов лет назад и проследить за эволюционными изменениям в той ветви, что ведет к нам от общего предка с шимпанзе, нашим ближайшим родственником на планете. Мы можем вернуться на 100 млн лет назад и увидеть точку, в которой появилось различие между сумчатыми и плацентарными млекопитающими. Мы можем бросить взгляд в еще более давнее прошлое, когда животных еще не существовало, и найти сотни генов простейших одноклеточных организмов, которые появились более 2 млрд лет назад, но все еще выполняют ту же самую работу для нас с вами.

Возможность поэтапного наблюдения меняет наше отношение к процессу. На протяжении сотни с лишним лет мы были ограничены наблюдением только внешних проявлений эволюции. Мы разглядывали окаменелости и сравнивали их с данными современной анатомии. Но до наступления молекулярной эры у нас не было возможности проводить сравнительный анализ видов на генетическом уровне. Мы могли изучать воспроизводство и выживание организмов и делать заключения о том, какие факторы влияют на эти процессы. Но у нас не было конкретных знаний о механизме изменчивости и о значимых признаках, определяющих различия между видами. Да, мы знали, что итогом эволюции является выживание наиболее приспособленного, но мы не знали, как создается этот наиболее приспособленный. Механизм любого сложного устройства (машины, компьютера, космического корабля) становится намного понятнее, если мы знаем, как оно сделано и чем каждая модель отличается от предыдущих версий. Мы уже не дикари, которые в изумлении провожают взглядом проплывающие мимо корабли.

Основное внимание в книге я уделяю объяснению того, как с помощью последовательности ДНК можно увидеть механизм эволюции в действии. Мы с вами увидим, как возникли некоторые наиболее интересные и важные способности многих удивительных существ. Книга состоит из трех основных частей. Я представляю их себе в виде трех составляющих хорошей, запоминающейся трапезы: небольшое вступление, обильная еда и полезная беседа. Сначала, чтобы подготовиться к вкушению пищи, я хотел бы объяснить вам суть основных ингредиентов эволюции — изменчивости, отбора и времени — и рассказать, каким образом они взаимодействуют, создавая наиболее приспособленные организмы.

Лауреат Нобелевской премии сэр Питер Медавар[9] однажды заметил, что «причины, заставившие всех без исключения профессионалов принять теорию эволюции, в большинстве своем настолько тонкие, что вряд ли могут быть поняты непрофессионалами».

Я не думаю, что это так. Но если это правда, то проблема заключается в неумении самих ученых доступно объяснить способность естественного отбора в сочетании с долгими временными интервалами создавать живые существа, большие и малые — от кита до бескровной ледяной рыбы.

Чтобы заполнить этот пробел, я постараюсь объяснить «бытовую математику» эволюции (глава 2). Это лучший способ почувствовать силу естественного отбора и поспорить с некоторыми ошибочными аргументами относительно вероятности эволюционных событий. В популярных изложениях теории эволюции эта простая математика обычно не приводится. Однако ее важно усвоить не только для того, чтобы поверить в возможность естественного отбора, но и для того, чтобы понять суть взаимодействия факторов изменчивости, отбора и времени. Я знаю, вы скажете: «Математика?! Только не это!» Не беспокойтесь, она проста. По меньшей мере эта глава поможет вам стать более успешным игроком или вкладчиком.

Основное содержание книги я представляю в виде обеда из шести блюд (шести глав). Каждая из них призвана показать, как новая информация, полученная из расшифровки ДНК, отражает тот или иной аспект эволюции. Мы познакомимся с доказательствами нового рода, о которых ни сам Дарвин, ни его математически одаренные ученики не могли и мечтать.

Сначала я расскажу о том, как в ДНК отражается процесс естественного отбора и наследования с изменениями в масштабе долгих геологических эпох. Я представлю неоспоримые доказательства того, что естественный отбор устраняет, говоря словами Дарвина, «вредные изменения» (глава 3). Доказательством является сохранение определенных генов во всех царствах живых организмов на протяжении 2 млрд лет или более. Содержание этих «бессмертных» генов остается неизменным в результате строгого контроля, осуществляемого естественным отбором. Бессмертные гены — это не просто стойкие борцы против нескончаемых мутаций, происходивших на протяжении всего этого времени, они являются важнейшим доказательством происхождения всех живых организмов от общих предков и дают нам новую возможность реконструировать ранние эволюционные события.

Затем я обращаюсь к рассмотрению очень важного вопроса о том, каким образом организмы приобретают новые признаки и более тонким образом настраивают уже существующие (глава 4). Я продемонстрирую это на нескольких замечательных примерах, касающихся происхождения и эволюции цветового зрения у животных. Цветовое зрение и его тонкая настройка играют важнейшую роль в жизни животных, в том, как они находят еду, партнеров и других себе подобных при свете, в темноте и в глубинах океана. Этапы развития и настройки цветового зрения на уровне ДНК особенно хорошо изучены и отлично показывают, как естественный отбор влияет на эволюцию генов.

Эти примеры эволюции в природе убедительно демонстрируют отдельные эпизоды и механизмы эволюционного процесса. Они подтверждают теорию, существующую уже много десятилетий. Однако дело обстоит гораздо интереснее: анализ ДНК преподносит нам и некоторые сюрпризы — неожиданную информацию, которая позволяет по-новому взглянуть на процесс эволюции. Такая информация — настоящий клад.

Изучение истории жизни на Земле в значительной степени основано на традиционном анализе окаменелостей — так вот, при анализе ДНК биологи тоже нашли определенный род окаменелостей — ископаемые гены (глава 5). Как осадочные породы содержат в себе следы древних форм жизни, которых больше не существует, так и в ДНК всех видов организмов содержатся гены (иногда исчисляемые сотнями), которые больше не используются и находятся на разных стадиях распада. Эти ископаемые гены, как те, о которых мы говорили в связи с ледяной рыбой, могут многое поведать о древних организмах и о том, в чем образ жизни их потомков стал иным. Наши с вами ископаемые гены рассказывают, чем мы отличаемся от предков-гоминидов.

И все же самое неожиданное открытие — это воспроизводимость и повторяемость эволюции (глава 6). Сравнивая виды, которые независимо друг от друга приобрели или потеряли аналогичные признаки, мы часто обнаруживаем, что эволюция повторяет саму себя, причем на уровне одного и того же гена, иногда путем изменения одной и той же позиции в этом гене. В некоторых случаях одни и те же гены становятся «ископаемыми» независимо у разных видов. Это замечательным образом доказывает, что на всем протяжении истории жизни отдельные виды, включая те, что принадлежат к совершенно разным таксономическим группам, под влиянием определенных условий изменялись одинаковым образом. Повторяемость эволюционных изменений распространена так широко, что мы вынуждены пересмотреть наши представления об уникальности событий прошлого. Летопись ДНК рассказывает нам не только о том, что у какого-то вида произошли те или иные генетические изменения, но и о том, что в сходных условиях многие разные виды с большой вероятностью будут меняться одинаково.

Повторение эволюционных событий не ограничено отдаленным прошлым или малоизвестными видами — оно происходит сейчас, в нашей с вами плоти и крови (глава 7). Наш вид сформировался под влиянием физической среды и патогенных организмов. С некоторыми древнейшими врагами, такими как возбудитель малярии, мы и сегодня вынуждены вести «эволюционную гонку вооружений», и следы суровых боев остались в наших генах. Я объясню, как процесс естественного отбора сформировал наше генетическое содержание и почему знание об этом так важно для развития медицины и понимания биологии человека.

Огромное множество доказательств, упоминаемых в этих пяти главах, не оставляют сомнений в повсеместности естественного отбора и в его способности уловить даже очень небольшие различия между особями. Однако еще со времен Дарвина самым сложным для понимания аспектом эволюционного процесса была кумулятивная способность естественного отбора направлять эволюцию сложных структур. На протяжении всего этого времени ученым не хватало детальной информации о механизмах формирования сложных органов и структур организма.

В заключительной части нашей трапезы я представлю новые данные о создании и эволюции сложности (глава 8). Я расскажу о том, как знание механизмов развития организма помогает понять устройство сложных структур и как сравнение структур разной степени сложности помогает понять ход их эволюции. Данные, записанные в ДНК, проливают свет на то, как сложность и разнообразие организмов развились на основе древних генов, контролирующих развитие тела.

Видеть и верить: почему эволюция так важна

Наблюдение за ходом эволюции в реальном времени и открытия, сделанные благодаря древней летописи ДНК, подготовят нас к нашей послеобеденной беседе. В двух заключительных главах книги мне придется поспорить с современными и старинными аргументами противников эволюции; я расскажу, как важно для современного человека понимать суть эволюционного процесса. Природа неприятия теории эволюции или сомнений в ней становится понятней из предшествующей истории всеобщего невежества и недоверия к науке — к Галилею, к Пастеру и даже к науке, доказавшей, что ДНК есть основа наследственности. Данные астрономии, микробиологии и генетики вызывали у многих сопротивление, и только обилие ощутимых и видимых доказательств могло победить его. Информация, хранящаяся в ДНК, не оставляет места для сомнений. Эволюция подтверждается бесспорными фактами, число которых продолжает расти.

Критики могут назвать данную книгу «геноцентричной» — в том смысле, что в ней особое место уделяется генам и ДНК. Это действительно так, но в оправдание такого подхода хочу сказать, что я подбирал такие примеры, которые ярче всего иллюстрируют способность видов адаптироваться к самым разным, зачастую довольно экстремальным условиям обитания.

Новое понимание того, как создавались наиболее приспособленные организмы, заставляет нас еще больше восхищаться фантастическим разнообразием форм жизни — от древнейших микробов, живущих в кипящей воде, до рыб, умеющих дышать без помощи гемоглобина, птиц и бабочек, которые видят невидимые для нас цвета, и приматов, умеющих писать книги. Кроме того, оно объясняет, почему «наиболее приспособленный организм» — весьма условное и относительное понятие.

Повседневная математика эволюции и летопись ДНК говорят о том, что естественный отбор действует лишь на те признаки, которые полезны в данный момент времени. Естественный отбор не может сохранить то, что уже не используется, и не может предугадать, что понадобится в будущем. Жить сегодняшним днем в определенной степени опасно — ведь, если внешние условия изменятся быстрее, чем возникнет адаптация к ним, быстрее, чем будут созданы «самые приспособленные», существование популяций и видов окажется под угрозой.

История показывает, что при глобальном или локальном изменении условий на смену тем, кто на протяжении многих эпох был самым приспособленным, приходили другие. Летопись окаменелостей пестрит останками множества существ — трилобитов, аммонитов, динозавров и многих других, — которые когда-то были очень успешны, но впоследствии оказались за бортом эволюции. Ледяным рыбам удалось удивительное эволюционное превращение, позволившее им адаптироваться к изменению условий в Антарктике, однако, возможно, это тупиковый путь. Эти животные изменили способ существования и лишились способностей, восстановить которые уже не удастся. Их будущее, вне всякого сомнения, находится под угрозой.

Дитлеф Рустад обнаружил ледяную рыбу в сетях совершенно случайно, когда занимался ловлей криля — ракообразных животных длиной 5–6 см, которые находятся в центре пищевой цепи в антарктическом регионе. В конце 2004 г. биологи проанализировали данные, собранные исследователями из девяти стран за 40 с лишним лет, и обнаружили, что запасы антарктического криля с 1920-х гг. снизились на 80 %. Криль питается фитопланктоном и водорослями, которых становится все меньше из-за таяния океанских льдов, а сам служит пищей для кальмаров, морских птиц, китов, тюленей и ледяных рыб. За последние 50 лет температура воздуха на Антарктическом полуострове стала выше примерно на 4–5 °C, а в следующем столетии, согласно прогнозам, в Южном океане на несколько градусов повысится температура воды. Если это произойдет, вполне возможно, что многие адаптированные к холоду виды не смогут среагировать на столь быстрые изменения температуры и состава пищи и рыбный промысел в Антарктике, включая ловлю ледяной рыбы, просто прекратится.

Таким образом, эволюционная биология представляет не только академический интерес, а признание добытых ею фактов — не из тех вопросов, которые могут решаться в ходе политических или философских дискуссий.

Сэр Питер Медавар говорил, что «альтернативой эволюционному способу мышления является отсутствие всякого мышления». И такую альтернативу мы как вид больше не можем себе позволить.

Голуби Дарвина. На примере большого разнообразия декоративных голубей, произошедших от сизарей, Дарвин иллюстрировал силу естественного отбора различных вариантов. Иллюстрации из сборника The Variations of Animals and Plants under Domestication, vol. 1, London: John Murray, 1868; монтаж Джейми Кэрролл.

Глава 2 Математика эволюции. Вероятность, отбор и время

Вся наука является не чем иным, как усовершенствованием повседневного мышления.

Альберт Эйнштейн

Раз в несколько месяцев по радио и телевидению сообщают, что джекпот популярной американской лотереи «Пауэрбол» до сих пор не взят и достиг гигантской суммы. Эти сообщения способствуют дополнительной продаже билетов среди тех, кто хочет разбогатеть таким достойным образом, и джекпот увеличивается еще больше. Многие жители штатов, где эта лотерея не разыгрывается, и даже те, кто обычно не покупает лотерейных билетов, проделывают немалый путь, чтобы все же купить несколько билетов, возможно, рассудив, что из-за 40 или 50 млн долларов суетиться не стоит, но 200 млн — это уже неплохие деньги.

Профессор Калифорнийского университета Майк Оркин считает, что вероятность погибнуть в автокатастрофе, проехав 25 км для покупки лотерейного билета, в 16 раз превышает вероятность выиграть джекпот. Минуточку, скажете вы, возможно, это верно, если купить всего один билет, но если купить несколько, то вероятность выигрыша вырастет. Да, это так, но, по расчетам того же Оркина, человек, покупающий 50 билетов каждую неделю, имеет шанс сорвать джекпот приблизительно один раз в 30 тыс. лет.

У нас действительно искаженные представления о статистике и теории вероятности, причем они не ограничиваются расчетом выигрыша в лотерею.

Случаи нападения акул неизменно попадают на обложки журналов (не говоря уже о сюжетах фильмов), и тот факт, что ежегодно опасность смертельного нападения акулы угрожает примерно одному человеку из 300 млн (в США), никак не ослабляет наш страх и болезненный интерес к этой теме. Но что там акулы, есть ведь еще и пумы! Опасность нападения пумы в Калифорнии, где численность этих животных растет, угрожает одному человеку из 32 млн в год. А вот вероятность умереть от укуса собаки в 50 раз выше (примерно один случай на 700 тыс. человек в год), но люди почему-то по-прежнему продолжают окружать себя этими симпатичными слюнявыми убийцами!

Что-то в нашей природе заставляет нас верить в возможность маловероятного события и при этом игнорировать гораздо более непосредственную и серьезную опасность. Очевидно, за рациональное мышление и статистический анализ отвечают разные участки нашего мозга.

Я привожу эти примеры по той причине, что эволюция также заключает в себе определенный элемент вероятности. И именно в этом кроется основной источник сомнений и путаницы. Некоторые люди, видя упорядоченность природы и изумительные способы адаптации живых организмов к окружающим условиям (как у ледяных рыб в ледяных водах Антарктики), не могут поверить, что во всем этом есть хотя бы небольшой элемент случайности. Скорее, считают они, случай мог бы воспрепятствовать появлению в природе чего-то нового, полезного и сложного. Чтобы разобраться в этом вопросе, нужно понять связь таких факторов, как вероятность, отбор и время. В этой главе я покажу, что понимание процесса эволюции (то есть изменения во времени) требует того же способа мышления и тех же математических знаний, которые мы используем (или должны использовать, если играем в лотерею) для расчета вероятности событий в каждодневной жизни.

Когда Альберта Эйнштейна спросили о том, что является самой могущественной силой во Вселенной, он ответил: «Сложный процент». Если бы Эйнштейн не был таким умным, он бы ответил: «Естественный отбор». Обе эти силы приводятся в движение одним и тем же математическим принципом. Этот принцип формулируется очень просто: даже при низких исходных значениях (например, небольшая сумма в банке) и низкой скорости ежегодного прироста (например, небольшая процентная ставка) при начислении сложных процентов в течение длительного времени исходная цифра кардинально увеличится.

Если речь идет об эволюции, «низким исходным значением» является число особей в популяции, обладающих определенным признаком, а «низкая скорость прироста» — это небольшое селективное преимущество, которое дает обладание этим признаком. Как мы увидим далее, «длительное время» для эволюции признака может оказаться гораздо более коротким, чем можно предполагать. Для широкого распространения признака в популяции нужно больше времени, чем время жизни одной особи, но часто это время не превышает нескольких сотен поколений. На шкале геологических эпох это краткий миг. Люди осознали это лишь через много лет после того, как Дарвин сформулировал теорию естественного отбора. Однако значение этого простого факта, основанного на простой математике, очень велико: небольшие различия между особями, накапливаясь под действием естественного отбора, через определенный промежуток времени могут привести к значительным различиям между видами.

Преодолеваем сомнения с помощью голубей и крыс

Тот, кто впервые открывает книгу «О происхождении видов», возможно, рассчитывает, что его ожидает красочное описание невообразимого разнообразия форм жизни или захватывающий рассказ о происхождении человека. Ни того ни другого там нет. В первой главе самой важной книги по биологии мы встречаемся… с голубями.

Да-да, после пятилетнего кругосветного путешествия и 20 с лишним лет исследований и работы над книгой Дарвин открывает свой главный труд описанием английских голубей.

Это первая из множества его блестящих находок.

Прежде чем приступить к объяснению идеи естественного отбора и происхождения всех видов от общих предшественников, Дарвин решил объяснить свою теорию на более понятном всем примере разведения голубей.

Сам Дарвин был экспертом по голубям. Вот как он пишет об этом в начале книги: «Полагая, что всегда лучше изучать какую-нибудь специальную группу, я после некоторого размышления остановился на домашних голубях. Я разводил все породы, какие только мог купить или достать, и получал шкурки, которые мне любезно присылали с различных концов света».

Голуби рассказали Дарвину о взаимосвязи изменчивости и отбора и убедили его в том, что естественный отбор слабых изменений может со временем приводить к значительным различиям между видами.

Дарвин указывал, что многие голуби настолько сильно отличаются друг от друга, что, если показать их орнитологу и сказать, что это дикие птицы, орнитолог отнес бы каждый вариант к отдельному виду. Однако сам Дарвин правильно понял, что все они являются потомками сизых голубей, и впоследствии применил свои знания о голубях для объяснения устройства природы в целом.

Натуралисты и селекционеры ошибочно считали, опираясь на внешние различия, что каждая порода домашнего животного (крупного рогатого скота, овец и др.) происходит от отдельного предка. Дарвин писал: «Когда я впервые завел у себя голубей и начал наблюдения над несколькими породами их, то, хорошо зная, насколько они при разведении в себе остаются постоянными, я был так же мало склонен допустить, что… все они произошли от одного общего родоначальника, как и всякому натуралисту трудно прийти к подобному выводу по отношению к многочисленным видам вьюрков или других птиц в естественном состоянии». Он так объяснял непонимание идеи отбора: «Специалисты слишком увлекаются различиями между интересующими их породами… и… отказываются от всяких обобщений, т. е. от суммирования в уме тех слабых различий, которые накопляются в течение длинного ряда… поколений [курсив Ш. К.]».

Дарвин был знаком со многими любителями голубей и знал от них, сколько времени занимает получение нового признака с помощью селекции. По его словам, самый искусный специалист, сэр Джон Себрайт, говорил, что готов получить голубя с любым оперением за три года, но для получения определенной формы головы или туловища ему нужно шесть лет.

Дарвин был уверен в том, что со временем естественный отбор может изменить очень многое. Но даже у самых горячих защитников его теории возникали сомнения.

Основным камнем преткновения был вопрос о том, является ли естественный отбор настолько эффективным, чтобы производить небольшие различия между особями, или он проявляется только в значительных изменениях. Самый верный сторонник Дарвина, биолог Томас Хаксли, несомненно, верил в отбор. Но и он считал, что трудно объяснить различия между современными и ископаемыми видами естественным отбором, длительно и непрерывно действующим на уровне небольших различий. Хаксли предпочитал считать, что отбор действует на уровне «сальтаций», то есть заметных скачкообразных изменений. Любимым примером Хаксли были люди и животные с дополнительными пальцами. Если такое отличие появляется всего за одно поколение, то, с точки зрения Хаксли, различие в количестве пальцев между разными видами скорее объясняется сальтацией, чем постепенным изменением. Хаксли придерживался такой точки зрения до конца своих дней. Вопрос о том, достаточно ли мощным механизмом является естественный отбор, чтобы отвечать за постепенную эволюцию сложных структур, остался в наследство следующему поколению биологов. И пока этот вопрос не нашел ответа, судьба теории Дарвина оставалась нерешенной.

Хаксли и Дарвин сошли в могилу, не имея никакого представления о механизме наследования признаков. Первые законы наследственности были открыты монахом-августинцем Грегором Менделем, когда он занимался экспериментами по разведению гороха в конце 1850-х и начале 1860-х гг. (то есть именно тогда, когда вышла книга Дарвина). Мендель знал о работах Дарвина, но великий натуралист ничего не слышал о работах Менделя, хотя немецкий журнал, в котором были опубликованы открытия Менделя, можно было найти и в Великобритании. Только в 1900 г., через 34 года после публикации и через 16 лет после смерти Менделя, научный мир обратил внимание на его труды.

Одним из тех, кто ухватился за идеи Менделя, был биолог из Кембриджского университета Уильям Бэтсон. Он занимался изучением законов изменчивости и написал большую книгу обо всех видах значительных дискретных вариаций, существующих в природе. Он считал, что нашел подтверждение тому, что естественный отбор действует на уровне больших различий между особями, и что дарвиновская версия постепенной эволюции путем отбора слабых изменений была ошибочной.

Бэтсон был уверен, что работы Менделя подтверждают его точку зрения. Мендель показал, что некоторые признаки гороха наследуются простым образом. В частности, форма и цвет горошин определяются отдельными факторами (теперь мы называем эти факторы генами). Для Бэтсона это было веским доказательством того, что эволюция имеет дело с крупными дискретными различиями, такими как сморщенная или гладкая форма гороха, зеленый или желтый цвет, но не с промежуточными формами. Сделанные Менделем открытия еще больше расширили пропасть между сторонниками и оппонентами теории естественного отбора. Было очевидно, что законы Менделя верны, так почему же тогда противостояние продолжалось и что же в конце концов переломило ситуацию в пользу теории Дарвина?

По иронии судьбы, поворотный момент произошел, как это часто бывает в науке, когда у сомневающейся стороны стало накапливаться все больше и больше фактов. Эта история в точности отразила предупреждение Т. Хаксли: «Наука учит меня с осторожностью соглашаться с тем, что соответствует моим предварительным гипотезам, и требовать для них более веских доказательств, чем для тех, с которыми я не соглашался».

Открытие Менделя активизировало множество исследований в области генетики, включая эксперименты по улучшению пород животных. Одной из наиболее видных фигур в этой области был Уильям Касл из Гарвардского университета, который быстро объединил законы Менделя о наследовании и теорию Бэтсона о прерывистых изменениях как основе эволюции. Однако достаточно скоро Касл вынужден был изменить свое отношение к идеям Бэтсона.

Изменение позиции Касла было связано с результатами длительной серии экспериментов по скрещиванию крыс. Сначала Касл и другие биологи полагали, что отбор не может привести к такому изменению признака, которое выходит за пределы исходного набора вариаций. Касл работал с так называемыми капюшонными крысами. Туловище у этих животных белое, а голова и плечи темные, как в капюшоне. Однако Касл и его студенты обнаружили, что в результате селективного скрещивания можно получить абсолютно новый вариант окраски. Некоторые особи имели промежуточный вариант окраски по отношению к исходным версиям, однако были и такие, окраска которых выходила за пределы исходного набора вариаций (рис. 2.1).

Рис. 2.1. Вариации окраски крыс в экспериментах Касла. Размер темного пятна («капюшона») на голове и спине крыс изменился в результате селективного скрещивания, и характер окрашивания вышел за пределы вариаций в родительских линиях. Это послужило важным доказательством могущества отбора. Из публикации W. E. Castle and J. C. Phillips (1914), Carnegie Institute of Washington Publication, no. 195.


Касл понял, что за окраску меха и создание непрерывного множества вариаций отвечают многие гены. Селекция, которую он проводил, действовала на сочетания вариантов этих генов. В конечном итоге он пришел к точке зрения, которая была противоположна его исходным взглядам и заключалась в том, что отбор незначительных различий в ряду непрерывных вариаций вполне может быть основой эволюции.

Эксперименты Касла и изменение его точки зрения были лишь одним из факторов, склонившим мнение ученых в пользу верности идей Дарвина. Кроме экспериментальных доказательств немаловажную роль сыграл математический подход, который стал применяться при изучении проблем эволюции, естественного отбора и генетики.

Алгебра эволюции

Еще один активный противник теории Дарвина, генетик Реджинальд Паннетт, инициировал определенные математические расчеты и тем самым непреднамеренно способствовал появлению новых подтверждений естественного отбора. Паннетт занимался изучением мимикрии у бабочек. Мимикрия — это имитация бабочками, съедобными для птиц, окраски других, несъедобных бабочек, проживающих на той же территории. Паннетт заинтересовался тем, как быстро естественный отбор может привести к распространению определенного признака в популяции бабочек или к его исчезновению, и обратился за помощью к математику Г. Т. Дж. Нортону.

Нортон занялся этим вопросом и, к большому удивлению Паннетта и многих других, обнаружил, что скорость отбора и эволюции может быть намного выше, чем предполагалось: «Эволюция, под которой в данном случае мы понимаем вытеснение одной формы другой формой, может происходить гораздо быстрее, чем мы подозревали до сих пор, поскольку естественный отбор, если имеет варианты для выбора, действует чрезвычайно стремительно».

Ключевое слово в этой цитате — «подозревали». Пока Нортон не поработал с числами, временные рамки процесса отбора на уровне популяции или вида оставались неопределенными.

Нортон поставил простой вопрос: если какой-то признак встречается в популяции с определенной частотой, как много времени понадобится для ощутимого снижения или повышения этой частоты при разных скоростях отбора? Ход мысли Нортона совершенно очевиден, и именно здесь мы сталкиваемся с аналогией с расчетом прибыльности банковских вкладов. Вопрос Нортона очень похож на следующий вопрос: «Как имеющаяся у нас сумма денег изменится со временем при разных процентных ставках?»

Те из моих читателей, чей возраст уже позволяет иметь пенсионные счета, или те, кому удалось накопить кое-какие сбережения, должны быть знакомы с механизмом начисления процентов. Количество чего угодно (денег, людей, рыбы) растет по экспоненциальному закону, если скорость роста пропорциональна текущему количеству. Когда речь идет о деньгах, рост капитала зависит от размера кумулятивной годовой ставки по вкладу (то есть ставки, учитывающей начисление процентов на проценты). При кумулятивной годовой ставке 7 % сумма на счету вкладчика будет удваиваться примерно каждые десять лет, а при ставке 1 % — лишь каждые 70 лет. Через 70 лет разница в размерах ставки приведет к тому, что сумма на счету у первого вкладчика удвоится семь раз, а у второго вкладчика — только один раз. Капитал первого вкладчика вырастет в 2х2х2х2х2х2х2=128 раз, а капитал второго — лишь в два раза, то есть по своей доходности эти вклады будут различаться в 64 раза. Таким образом, разница между ставками в 6 %, очевидно, кое-что значит.

В биологии бесконечный экспоненциальный рост невозможен, поскольку живые организмы умирают и их источники ограниченны. Известно изречение Дарвина о том, что у пары слонов, которые за 60 лет производят на свет шесть детенышей, через 500 лет будет 15 млн потомков, причем с учетом смерти животных от старости. Однако все живые организмы конкурируют между собой за территорию, источники пищи и воды. Эта конкуренция ограничивает рост популяции, но при этом является важнейшим условием естественного отбора. Там, где есть конкуренция (а она происходит повсеместно) и наследование вариаций признаков, действует естественный отбор.

Для количественного определения силы естественного отбора биологи используют так называемый коэффициент отбора (обозначается через s — от selection), который аналогичен процентной ставке. Этот коэффициент показывает разницу в приращении численности особей, которые имеют определенный признак, и тех, которые его не имеют. Если, например, наличие какого-то признака дает особям некоторое преимущество и позволяет произвести на свет 101 жизнеспособного потомка, в то время как особи без этого признака производят на свет лишь 100 потомков, имеет место преимущество в 1 % (кумулятивная ставка 1 %), a s = +0,01. Если наличие какого-то признака является небольшим недостатком и позволяет произвести на свет не 100, а лишь 99 потомков, s = -0,01. Эти положительные или отрицательные значения коэффициента отбора отражают приспособленность, которая представляет собой относительный, а не абсолютный показатель.

Подобно тому как Эйнштейн и удачливые вкладчики оценили силу кумулятивной процентной ставки, так биологи при помощи Нортона оценили силу естественного отбора. Например, Нортон рассчитал, что скромное селективное преимущество 0,01 позволит доминантному признаку, встречающемуся лишь у восьми особей из 1000, достичь частоты встречаемости 90 % всего через 3 тыс. поколений. При десятикратном повышении селективного преимущества (s = 0,1) это значение достигается всего через 300 поколений. Поскольку время жизни поколения у многих видов организмов не превышает одного года, эти расчеты потрясли многих биологов. Появились и другие математические расчеты, в частности сделанные Джоном Верденом Сандерсоном Холдейном, который вместе с Роландом Фишером и Сьюэлом Райтом вывел набор формул, позволяющих понять связь между эволюцией, отбором и временем в широком диапазоне условий.

До сих пор я говорил о распространении уже имеющихся признаков в популяции, однако естественный отбор может обеспечить и экспоненциальное изменение этих признаков. Рассмотрим геометрические размеры какого-нибудь организма — высоту растения или длину тела животного. Мы знаем, что в популяции диких растений и животных эти параметры варьируют в каких-то пределах. Теперь предположим, что в каждом поколении у более высоких растений или более длинных животных имеется некоторое селективное преимущество. Если скорость изменения размера составляет всего 0,2 % за одно поколение (то есть приращение растения высотой 1 м или животного длиной 1 м составляет всего 2 мм), поначалу такое изменение будет незаметным. Однако всего через 200 поколений высота или длина этих растений или животных увеличится на 50 %.

Подобные расчеты показывают потенциальную мощь и скорость естественного отбора. Теперь посмотрим, что же происходит на самом деле.

Естественный отбор в дикой природе

За отбором гораздо легче следить в теории с помощью математических расчетов, чем в реальной ситуации в дикой природе. Кроме сложностей, связанных с контролем внешних условий, существует два основных осложняющих фактора, влияние которых ощущается очень сильно. Первый фактор — время. Если процессы протекают слишком медленно, то за время проведения эксперимента никаких изменений зафиксировать не удается. Вторая сложность — количество необходимых измерений. Для детекции слабых селективных преимуществ или недостатков необходим большой объем данных.

Второй фактор связан с вероятностью и статистикой. Если различие в приспособленности двух форм одного и того же вида очень незначительное, то для преодоления ошибки эксперимента и случайных вариаций необходимо провести измерения на большом количестве особей. Проиллюстрируем это на простом примере.

Предположим, мы хотим определить, имеет ли у какого-то вида животных один вариант окраски преимущество над другим. Сколько животных нужно осмотреть, чтобы выявить отклонение от некоего ожидаемого соотношения? Допустим, речь идет о многочисленной популяции, скажем, о популяции рыб, которых легко выловить и посчитать. Теория вероятности гласит, что чем большее число особей мы изучим, тем точнее полученный результат будет отражать реальное количество каждого варианта окраски рыб в популяции. Сколько нам нужно рыб, чтобы получить результат с доверительной вероятностью 95 % (что означает, что в 95 случаях из 100 истинное значение оцениваемой величины попадет в определенный нами интервал)? Как видно из представленной ниже таблички, погрешность эксперимента уменьшается при увеличении числа измерений.

Если мы осмотрим всего 100 рыб, погрешность может достигать 10 %. При такой высокой вероятности ошибки слабых изменений не различить. (Такая же проблема возникает при опросах на выходе с избирательных участков: выборка слишком мала, и поэтому предсказания результатов иногда бывают ошибочными.)

Поскольку выявить слабые различия среди диких животных так сложно, большинство известных примеров касается действия очень сильного и, следовательно, очень быстрого отбора. Самый известный пример — меланизм у березовой пяденицы. Индустриальная революция привела к загрязнению отдельных районов Англии и Северной Америки, что затруднило рост лишайников и изменило цвет стволов деревьев, на которых пяденица скрывается от птиц. В результате произошло очень резкое и быстрое увеличение численности темноокрашенных форм бабочек и такое же быстрое сокращение численности светлоокрашенных форм. Всего за 50 лет, примерно с 1848 по 1896 г., количество темноокрашенных особей, изначально очень редких, в некоторых районах достигло 98 %. Холдейн проанализировал статистические данные по двум формам бабочек и обнаружил, что коэффициент отбора светлых бабочек на темных деревьях составил примерно -0,2. Может показаться, что преимущество в 20 % — не так уж много, но, нарастая год за годом подобно кумулятивной процентной ставке, такое преимущество обеспечивает очень быстрое распространение формы в популяции. Во второй половине XX в. были приняты законы об охране окружающей среды, отбор изменил свое направление, и в некоторых районах было зарегистрировано сокращение доли темноокрашенных особей березовой пяденицы от 90 до 10 % (рис. 2.2).

Рис. 2.2. Сокращение численности темноокрашенной формы березовой пяденицы в результате улучшения качества воздуха. При изменении внешних условий доля темноокрашенного варианта пяденицы значительно сократилась как в США [черные квадратики], так и в Великобритании [черные кружочки]. Светлые кружочки соответствуют теоретической кривой изменений численности при значении коэффициента отбора s = -0,15. Рисунок взят из статьи B. S. Grant et at., 1996, Journal of Heredity 87: 3551 (с изм.).


Естественный отбор березовой пяденицы осуществляют птицы. И это вводит в нашу задачу еще одну переменную, которая усложняет изучение естественного отбора в дикой природе. Может потребоваться анализ не только большого количества бабочек, но и разнообразных факторов отбора, действующих на них. Если хищников несколько и если условия изменяются в зависимости от региона, времени суток и т. д., возникают дополнительные трудности. В случае березовой пяденицы быстрое изменение численности двух форм, происходившее одновременно на двух континентах и связанное с активным развитием промышленности, ясно указывает на то, что в данном случае шел естественный отбор по окраске.

История с березовой пяденицей — лишь один из известных примеров. Естественный отбор животных с различной окраской был описан для улиток, божьих коровок, мешотчатых прыгунов и других видов животных; факторы отбора в одних случаях удалось установить точно, в других — предположительно. Для некоторых из этих видов коэффициент отбора определенного типа окраски достаточно высокий (от 0,01 до 0,5).

Важно понять, что длительные исследования естественного отбора в дикой природе требуют героического упорства ученых, постоянной финансовой поддержки и благосклонности самой природы. Можно сказать, что в полевых условиях происходит естественный отбор среди ученых: работать остаются лишь самые стойкие.

Недавние исследования взаимоотношений соколов и одичавших голубей, длившиеся семь лет, свидетельствуют о том, какое необыкновенное терпение требуется для изучения естественного отбора в дикой природе. В районе города Дэвис в Калифорнии встречаются голуби с шестью вариантами окраски оперения, и эти голуби являются излюбленной пищей сокола-сапсана. Все голуби имеют серо-голубое оперение, но у одного варианта этих птиц в нижней части спины выше хвоста есть белое пятно, которого нет у других (рис. 2.3).

Рис. 2.3. Варианты окраски хвостовой части оперения у голубей. В популяции городских голубей имеются особи с белыми перьями в нижней части спины (слева); такая окраска дает им определенное преимущество при нападении сокола-сапсана. Рисунок Джейми Кэрролл.


Группа исследователей под руководством Альберто Паллерони из Гарвардского университета в мельчайших деталях изучила воздушный бой между соколом и голубем. За семь лет ученые стали свидетелями 1485 (!) нападений пяти взрослых соколов на голубей (рис. 2.4). Ученые проанализировали связь окраски голубей с количеством и успешностью нападений соколов. Для этого они пометили и описали 5235 голубей — это очень большая выборка.

Рис. 2.4. Охота. При нападении сапсан может развивать скорость до 70 м/с. В данном случае голубю явно угрожает опасность. Фотография Роба Пальмера, печатается с любезного разрешения Альберто Паллерони.


Исследователи обнаружили, что соколы нападают на голубей с белым пятном на спине реже, чем на других голубей, и вероятность удачной охоты на них ниже. В этом регионе голуби с белым пятном составляют 20 % всех голубей, а среди жертв соколов на их долю приходится всего 2 %.

Паллерони с коллегами объяснили подобное преимущество голубей с белыми перьями на спине их поведением при нападении сокола. Когда при виде добычи сокол разгоняется до 70 м/с, голубь складывает крылья и «скатывается» с траектории движения сокола. Биологи предположили, что белое пятно отвлекает нападающего сокола, когда голубь начинает свой кувырок, и это дает голубю дополнительную долю секунды, чтобы увернуться от хищника.

Чтобы проверить свою гипотезу, исследователи изменили окраску 756 голубей, «пересадив» белое пятно на голубей без пятна (для этого они выстригали белые перья у голубей с пятном и приклеивали их серым голубям). Затем птиц выпускали и следили за их судьбой при нападении сокола. Ситуация изменилась кардинальным образом. Голуби, которые раньше имели пятно, теперь становились добычей соколов не реже, чем все остальные, а сизые голуби с приклеенными белыми перьями оказались защищенными.

В ходе этого потрясающего исследования ученые отметили постоянное увеличение доли голубей с белым пятном на спине среди всей популяции голубей. Они в реальном времени наблюдали эволюцию этих птиц в условиях естественного отбора.


Исследование естественного отбора в дикой природе не сводится исключительно к анализу таких простых признаков, как окраска. Прекрасный пример — изучение эволюции трехиглой колюшки. Судя по геологическим данным, при отступлении ледников в конце последнего ледникового периода морская колюшка, заселившая реки и озера, оказалась в изоляции. Эти пресноводные популяции стали постепенно отличаться от своих морских предков. Морская форма колюшки обычно имеет на боках непрерывный ряд из 30 и более костных пластинок. Но у многих пресноводных популяций количество костных пластинок сократилось до 0–9. Селективное преимущество от сокращения числа пластинок для пресноводных рыб, по-видимому, объясняется большей гибкостью тела и повышенной маневренностью.

Ученые следили за эволюцией колюшки и в режиме реального времени. Озеро Лоуберг на Аляске было заселено морской колюшкой после проведения в 1982 г. программы химического уничтожения местной популяции колюшек. Регулярный анализ, проводившийся с 1990 по 2001 г., показал, что всего за 12 лет доля океанической формы колюшки сократилась со 100 до 11 %, а доля форм с малым количеством костных пластинок достигла 75 %; еще одну небольшую часть составляют различные промежуточные формы (рис. 2.5). Эволюция колюшки в озере Лоуберг показывает, что эта рыба способна адаптироваться к жизни в пресной воде всего за десять лет после переселения из океана. Поскольку колюшка так быстро адаптируется к новым условиям обитания, она является прекрасной моделью для изучения эволюции, и мы вновь обратимся к ней в восьмой главе.

Рис. 2.5. Быстрая эволюция костных пластинок у трехиглой колюшки. В североамериканских озерах океаническая колюшка адаптировалась к новым условиям жизни путем сокращения числа и размера защитных костных пластинок на боках. Из статьи M. A. Belletal., 2004, Evolution 58:814.


Приведенные примеры иллюстрируют быстроту эволюции и силу естественного отбора в отношении уже существующих в популяции вариантов. Но откуда берутся эти варианты? И что происходит, если нужные варианты отсутствуют? Как долго популяция может «ждать» появления новых вариантов?

Лотерея мутаций: все мы мутанты

Источник любых изменений — мутация. Слово это приобрело множество значений, что стало причиной двух широко распространенных заблуждений, которые я сразу же хочу развеять. Первое заблуждение заключается в том, что все мутации вредны и, следовательно, не могут быть созидательными, лишь разрушительными. Это совершенно неверно, как показывает пример ледяной рыбы. Мы увидим, что вероятность появления полезной мутации гораздо выше, чем вероятность покупки выигрышного лотерейного билета. Второе заблуждение заключается в том, что если мутации возникают случайно (а это так и есть), то они не могут вносить вклад в создание сложных и упорядоченных систем в живой природе. Это заблуждение связано с неумением различать мутацию и отбор. Возникновение мутаций — слепой процесс, а естественный отбор таковым не является. Мутации приводят к появлению случайных вариаций, а отбор разделяет выигравших и проигравших. Кроме того, естественный отбор — это кумулятивный процесс. Рим и его жители возникли не за один день, и не за мгновение замерзли антарктические моря и сформировались ледяные рыбы. Эволюция создавала ледяную рыбу, человека и другие виды животных на протяжении сотен тысяч и миллионов поколений. В уже функционировавших существах появлялись новые мутации. Они не могли и не должны были приводить к мгновенному появлению сложных структур или функций.

Чтобы оценить созидательную способность мутаций, мы должны знать, какие бывают мутации и с какой частотой они происходят. За полвека исследований у нас сложилась четкая картина динамических изменений в ДНК. Я коротко остановлюсь на том, каким образом мутации могут изменять последовательность ДНК.

Для собственного воспроизводства любой организм должен уметь копировать свою ДНК. Создание копии ДНК — сложный биохимический процесс. В ходе этого процесса возникают ошибки, и если они не исправляются быстро и должным образом, рождаются мутации. Существует великое множество видов мутаций. Если рассматривать ДНК как текст, то разные типы мутаций соответствуют разным типам ошибок при переписывании. ДНК любого вида представляет собой от миллионов до миллиардов комбинаций букв A, C, G и T. Самая распространенная ошибка (опечатка) заключается в замене правильной буквы на неправильную. Но могут происходить и другие события, такие как инсерции (включения) или потери (делеции) отдельных букв и групп букв. Также возможны ошибки копирования и вставки: так возникают удвоения (дупликации) фрагментов текста. С разной частотой могут возникать повторы нескольких букв, целых генов или даже групп генов (удвоение генов может расширять информационное содержание ДНК, и в четвертой главе мы увидим, что дупликация ДНК является важным источником новых признаков). Участки последовательностей ДНК также подвергаются изменениям в результате инверсий и перестановок фрагментов. Таким образом, в каждом новом организме имеются новые мутации.

Ученые изучали частоту возникновения мутаций у многих видов организмов. На семь миллиардов оснований ДНК в организме каждого человека приходится примерно 175 новых мутаций. Как сказал биолог Арман Леруа, «мы все мутанты».

«Подождите! Как же это возможно? — воскликнете вы. — Разве мутации не вредны?» Да, некоторые вредны, но не все. Мы в большинстве случаев не страдаем от этих 175 мутаций по той причине, что они: 1) происходят в тех участках ДНК, где нет значимой информации; 2) возникают внутри гена или рядом с ним, но не влияют на его работу; 3) компенсируются наличием второй копии гена, которая обычно имеется у каждого индивида, или 4) воздействуют на ген таким образом, что его функция изменяется лишь в допустимых пределах. Именно вариации размера, формы, цвета и других физических и химических признаков делают каждого из нас уникальным существом. Это и есть сырьевой материал для работы эволюции.

Я приведу конкретный пример, который иллюстрирует высокую вероятность возникновения полезных для адаптации мутаций (в последующих главах я приведу множество других примеров адаптационных изменений). Представим себе популяцию диких мышей, все представители которой имели светлую окраску и жили на песчаной почве. И вот через столетия или тысячелетия геологическая активность в местах обитания этих мышей привела к извержению вулкана и выбросу лавы. Остывшая лава образовала на поверхности земли черные каменистые выступы. Окраска мышей перестала соответствовать цвету почвы: на темном фоне их светлая шкурка стала хорошо видна хищникам, таким как филины и совы. Темные мыши были бы в этих условиях более защищенными. Итак, мы хотим узнать:

• сколько времени потребуется для появления в популяции светлых мышей мутаций, обеспечивающих темную окраску;

• как быстро подобные мутации распространятся в популяции.

Ответ на первый вопрос зависит от комбинации вероятности и времени. Для решения следует прибегнуть к тем же расчетам, которыми пользуются для определения вероятности выигрыша в лотерею. Ответ на второй вопрос зависит от связи между отбором и временем. И об этой математике мы уже говорили.

Скорость появления мутаций у мышей достаточно хорошо изучена. Исследователи из лаборатории Джексона[10] в Бар-Харборе, штат Мэн, занимались скрещиванием мышей на протяжении нескольких десятилетий и располагают информацией о частоте спонтанных мутаций, основанной на изучении миллионов мышей. Если говорить о мутациях отдельных оснований ДНК, то они у каждой мыши происходят примерно в двух позициях на каждый миллиард оснований (всего в геноме мыши этих оснований около 5 млрд). В гене среднего размера существует около 1 тыс. позиций, в которых может произойти мутация. Учитывая наличие 1 тыс. позиций для мутации в каждом гене и возможность возникновения двух мутаций в каждом миллиарде позиций, получаем, что мутация в конкретном гене имеет место у одной из 500 тыс. особей. Таким образом, процесс копирования ДНК является достаточно точным, но не безупречным.

Кроме того, нам известно, что мутации многих генов могут привести к изменению окраски животного. Я расскажу о роли всего одного гена, мутантные варианты которого были получены в лаборатории Джексона и о котором мы знаем достаточно много. Многие мутации этого гена, названного MC1R, приводят к тому, что мышь приобретает черную окраску, если у нее есть хотя бы одна копия мутантного гена.

Чтобы рассчитать частоту появления мутаций, отвечающих за темную окраску мышей, я буду исходить из следующих допущений.

Теперь перемножим эти значения: 10 позиций в гене MC1R умножим на 2 гена у каждой мыши и на 2 мутации на каждый миллиард позиций и получим 40 мутантов на каждый миллиард мышей. Таким образом, каждая мышь имеет один шанс из 25 млн получить мутацию гена MC1R, способствующую появлению темной окраски.

Может показаться, что это очень маленький шанс, но мы пока не учли численность популяции и скорость воспроизводства мышей. Частота появления мутации зависит от размера популяции и уровня рождаемости. Мышей много; в каждом поколении появляется на свет множество детенышей. В той популяции мышей, о которой я рассказываю, насчитывается от 10 тыс. до 100 тыс. особей. Чтобы оценить частоту появления черных мутантов, нужно учесть еще и плодовитость мышей. Самки этого вида мышей приносят от двух до пяти детенышей два или три раза в год. Допустим, каждая самка приносит пять детенышей в год. Если умножить число самок на число детенышей каждой самки, мы получим количество новорожденных мышат в год в данной популяции. Предположим, в популяции 10 тыс. мышей; половину из них составляют самки; каждая приносит по пять мышат. Таким образом, в этой популяции ежегодно появляется 25 тыс. мышат. Теперь умножим это число на 1/25 000 000 (вероятность мутации у одной особи) и получим, что одна черная мышь появляется один раз в 1 тыс. лет. Таким образом, за миллион лет мутации, приводящие к появлению черной окраски, могут независимо возникнуть 1 тыс. раз. Итак, в нашей популяции из 10 тыс. особей черная мышь появляется один раз в 1 тыс. лет. Если численность популяции составляет 100 тыс. мышей, черные особи появляются чаще — один раз в 100 лет. Для сравнения, если вы покупаете 10 тыс. билетов лотереи «Пауэрболл» в год, то будете выигрывать каждые 7500 лет.

Теперь поговорим о скорости распространения черной окраски в популяции. После того как мутация появилась, ее распространение зависит от скорости отбора и от времени. Ключевую роль в этом процессе играет селективное преимущество черного меха и эффективный размер популяции (это не общее число особей, а количество участвующих в размножении особей с учетом дополнительных факторов; этот параметр обозначают как Ne). Чем больше преимущество, тем быстрее распространяется признак, но чем больше размер популяции, тем больше времени требуется для того, чтобы все мыши стали черными. Для расчета времени (f, измеряется в поколениях), за которое все мыши станут черными, можно воспользоваться формулой:

t = (2/s) In (2Ne).

Ниже представлено несколько значений t при разных значениях преимущества s в популяции из 10 тыс. особей. Обратите внимание, что при повышении коэффициента отбора время, необходимое для распространения благоприятной мутации, сокращается.

s = 0,001, t = 19 807 поколений

s = 0,01, t = 1981 поколение

s = 0,05, t = 396 поколений

s = 0,1, t = 198 поколений

s = 0,2, t = 99 поколений

Оценочное значение коэффициента отбора темных мышей, живущих на поверхности лавы, превышает 0,01. Как следует из таблички, в этом случае мутация, ответственная за темную окраску меха, распространится по всей популяции менее чем за 2 тыс. поколений, или менее чем за 2 тыс. лет. Таким образом, даже мутация, приносящая небольшое преимущество, распространяется в популяции за весьма короткий отрезок времени по геологической шкале.

Чтобы точнее оценить вероятность событий, происходящих в природе, необходимо учесть еще несколько факторов. Одним из этих факторов является вероятность потери полезной мутации до того, как она начнет распространяться. Мыши или их потомки могут не дожить до половой зрелости или не передать мутацию своим потомкам. Вероятность потери мутации также зависит от комбинации случайности и отбора. Я не стану выводить формулу, только скажу, что вероятность успешного распространения мутации в популяции приблизительно вдвое превышает коэффициент отбора. В нашем случае, когда мутация обеспечивает небольшое преимущество с s = 0,01, вероятность распространения мутации составляет 2 %. Если бы коэффициент s был равен 0,05, вероятность распространения мутации составляла бы 10 %. Таким образом, если за 1 млн лет мутация может появиться 1 тыс. раз, за это время она имеет возможность распространиться от 20 до 100 раз.

Кроме того, в приведенных выше расчетах я не учитывал миграцию животных. На самом деле животные не сидят на месте — в частности, мыши могут перемещаться из областей со светлым песком в области с темной почвой и наоборот. При этом на светлой почве имеют преимущество светлые мыши, а на темной — темные. Это усложняет описание реальной картины, но не влияет на вывод о том, что эволюция может идти очень быстро.

Важно учитывать, что расчет времени появления нового варианта окраски был основан на том, что вся популяция мышей имела окраску, адаптированную к обитанию на песчаной почве. В реальности в любой популяции мышей, голубей, людей или других видов организмов обычно существует множество вариантов признака. В качестве примера на рис. С представлено 18 вариантов окраски одного вида подвязочной змеи.

Я привожу пример с окраской мышей по той причине, что он иллюстрирует временные рамки, в пределах которых мутации и отбор в типичной популяции животных приводят к эволюционным изменениям. Но еще этот пример хорош тем, что он отражает реальную ситуацию. В пустыне Пинакате в Аризоне есть участки земли, покрытые черной лавой в результате вулканических извержений, произошедших миллионы лет назад. Здесь живут мыши двух цветов — черные и песочные. Майкл Нахман из Университета Аризоны и его коллеги показали, что мыши песочного цвета чаще встречаются на песчаной почве, а черные мыши — на темных лавовых полях (рис. 2.6).

Рис. 2.6. Окраска диких мышей. Темные мыши (верхний рисунок) чаще встречаются на черной каменистой земле, тогда как светлые мыши (нижний рисунок) обитают на песчаной почве. Из статьи S. B. Benson, 1933, University of California Publications in Zoology 40:1.


Ученые также установили генетическую основу различия между темными и светлыми мышами (подробнее мы поговорим об этом в шестой главе). Этот пример хорош тем, что в нем реальные экологические и генетические данные демонстрируют действие естественного отбора в реальных временных рамках. Вывод из этого и многих других подобных примеров заключается в том, что мутации могут быть «созидательными» и что эволюцию ограничивает не потенциальная возможность мутаций, а экологическая необходимость.

Время

В 2004 году многие фанаты бейсбола были полностью поглощены переживанием события, свершившегося впервые за 86 лет: моя любимая бостонская команда Red Sox выиграла чемпионат США. Наши представления о времени в значительной степени определяются продолжительностью нашей собственной жизни. Представляете себе, фанаты запели впервые за 86 лет! Для нас это целая вечность, но на часах эволюции это лишь краткий миг.

Даже 230 лет для нас чрезвычайно большой срок — ведь наша страна была основана так давно.

Тысячу лет назад? Темные века. Невозможно себе представить.

Десять тысяч лет? В эти рамки укладывается вся история человеческой цивилизации.

Я хочу сказать, что миллион лет — это гигантский отрезок времени. Этого времени вполне достаточно, чтобы появились варианты ключевых генов, а какие-то гены стали ископаемыми. Этого времени более чем достаточно, чтобы естественный отбор привел к распространению какого-либо признака. За один миллион лет размер мозга наших предков увеличился вдвое. Это довольно серьезное изменение большого эволюционного значения, но за это время сменилось около 50 тыс. поколений людей. Для формирования ледяной рыбы из обитавшего в теплой воде предшественника с красной кровью потребовалось от 15 млн до 25 млн лет — опять же весьма солидный отрезок времени, достаточный для осуществления целой серии изменений. Реальная скорость эволюции значительно ниже максимально возможной скорости.

Важно понять, что отбор и мутации происходят в природе беспрерывно, буквально ежедневно. Окружающая среда постоянно влияет на живущие и размножающиеся в ней виды. Эволюция — это непрекращающийся процесс. Как мы не замечаем, на сколько с каждым днем подрастают наши дети или трава в саду, так незаметны для нас в повседневной жизни изменения климата и взаимные превращения видов. Но на больших временных отрезках изменение оказывается правилом, а не исключением. Простая математика эволюции позволяет нам ощутить связь и силу случайных мутаций и естественного отбора, помноженных на время.

Также важно понять, что отбор действует только в настоящем времени, в конкретных внешних условиях. Он не может влиять на то, в чем данный вид уже не нуждается, и на то, в чем пока еще нет нужды. Таким образом, наиболее приспособленный организм — это относительное понятие, временный статус, а вовсе не абсолютное или перманентное звание.

Летопись ДНК: отслеживаем этапы эволюции

Если дни, годы, да и целая жизнь человека — слишком краткий срок для регистрации изменений, как же наблюдать за созданием наиболее приспособленного организма? Практически вся история жизни и большая часть биоразнообразия относятся ко времени, предшествующему появлению первых документальных свидетельств истории человечества. Так как же узнать, что происходило в далеком прошлом? Как проникнуть в глубь времен и понять, каким образом эволюционировали виды и признаки?

Ответы на эти вопросы можно найти в последовательностях ДНК.

Непрерывность потока мутаций ДНК оказалась чрезвычайно важной для изучения эволюции. Известная частота мутаций позволяет биологам предсказать наличие определенных закономерностей в текстах ДНК. На уровне ДНК отбор способствует сохранению «успешных» версий отдельных генов. В результате мутаций в популяции могут одновременно существовать две или более версий конкретного гена. Судьба этих альтернативных версий зависит от условий отбора. Допустим, у нас есть две версии гена — A и B. Если A лучше обеспечивает выживание и воспроизводство вида, чем B, то отбор будет благоприятствовать форме A. Напротив, если более удачной версией является B, отбор будет благоприятствовать сохранению формы B.

Существует еще и третья возможность, которую биологи-эволюционисты осознали лишь тогда, когда научились определять последовательности генов и белков. Этот третий вариант реализуется в том случае, когда различие между версиями A и B — нейтральное, не влияющее на приспособленность организма. Раньше эволюционисты считали, что естественный отбор «отслеживает» абсолютно все изменения. Однако в 1960-х гг. Мотоо Кимура предположил, что существует множество нейтральных изменений, на которые отбор не действует. Значение так называемой нейтральной теории Кимуры заключается в том, что она описывает закономерности изменения ДНК во времени при отсутствии влияния дополнительных факторов. Если наблюдаемое изменение не соответствует тому, что должно было бы наблюдаться при нейтральной эволюции, это важный сигнал: значит, в дело вступил естественный отбор. Такие сигналы указывают на то, что отбор либо благоприятствовал какому-либо специфическому изменению, либо последовательно отбраковывал другие.

В следующих шести главах я расскажу о том, как эволюция видов и признаков отражается в ДНК. В трех главах я покажу, как естественный отбор отбраковывает вредные изменения (глава 3), благоприятствует полезным изменениям (глава 4) и не влияет на нейтральные изменения (глава 5). Мы увидим множество примеров того, как наличие или отсутствие естественного отбора оставляет характерные следы в ДНК. Я начну с рассмотрения самых древних из известных нам генов, которые ведут свое начало от первых клеточных форм жизни на нашей планете, появившихся более 3 млрд лет назад.

Жизнь в экстремальных условиях. Тройной Западный гейзер в Национальном парке Йеллоустон, один из многих термальных источников, где живут микроорганизмы, приспособленные к жизни при высокой температуре. Фотография Джейми Кэрролл.

Глава 3 Бессмертные гены. Бег на месте в погоне за вечностью

Совершенно очевидно, что все в природе изменяется, но за всеми этими изменениями стоит нечто вечное.

Иоганн Вольфганг Гете

Он не искал нового царства.

В конце лета 1966 г. микробиолог Том Брок вместе со своим студентом Хадсоном Фризом бродил вокруг гейзеров и горячих источников в Национальном парке Йеллоустон. Их интересовали микробы, живущие в прудах и окрашивающие почву вокруг некоторых источников в оранжевый цвет.

Ученые взяли образцы микроорганизмов из Грибного источника — большого пруда с температурой воды 73 °C, что в те времена считалось максимально высокой температурой, при которой могут существовать живые существа. Из образцов удалось выделить новую бактерию, обитающую в горячей воде. Оптимальная температура роста этой бактерии как раз близка к температуре горячего источника, из которого она была впервые выделена. Ученые назвали этот термофильный организм Thermus aquaticus. А еще Брок обратил внимание на розовые волокна вокруг некоторых источников с еще более горячей водой; эти волокна вызвали у него подозрение, что жизнь может существовать и при более высокой температуре.

В следующем году Брок вновь отправился в Йеллоустон «на рыбалку» за микробами. Его оснащение было простым: он привязывал к леске одно или два микроскопических стекла и забрасывал их в пруд, а другой конец лески привязывал к бревну или камню (не пробуйте воспроизвести этот эксперимент самостоятельно: вас арестуют, и, кроме того, вы можете очень сильно обжечься). Через несколько дней он вытаскивал стекла и обнаруживал на них заметный микробный рост, иногда такой значительный, что стекла были покрыты видимой глазом пленкой. Брок был прав, предположив, что микробы могут жить и в более горячей воде, но он и сам не предполагал, что они могут жить в кипятке. И эти микробы не просто переносили температуру 95 °C и выше, им было хорошо в дымящейся, кислой и кипящей воде, как в Серном котле в районе грязевых вулканов в парке Йеллоустон. Находки Брока в Йеллоустоне открыли людям глаза на существование удивительной адаптационной способности различных форм жизни, позволили обнаружить странных, но важных существ, таких как Sulfolobus и Thermoplasma, и положили начало научному исследованию так называемых гипертермофилов — микробов, живущих при очень высокой температуре.

После открытия Броком мира гипертермофилов последовали еще три открытия, внесшие важный вклад в развитие биологии. Все обнаруженные микроорганизмы Брок отнес к бактериям. Под микроскопом они действительно выглядели как обычные бактерии (рис. 3.1).

Рис. 3.1. Микроорганизмы из горячего источника. Эта фотография, полученная методом сканирующей электронной микроскопии, демонстрирует рост различных микробов на стекле, помещенном в Обсидиановое озеро в Национальном парке Йеллоустон. Из статьи P. Hogenholtz et al., 1998, Journal of Bacteriology, 180:366.


Однако примерно через десять лет Карл Воуз и Джордж Фокс из Университета Иллинойса обнаружили, что различные виды микроорганизмов, предпочитающие расти при высоких концентрациях серы, метана или соли, на самом деле образуют отдельное царство. Они в такой же степени отличаются от бактерий, как бактерии отличаются от эукариот (к которым относятся животные, растения, грибы и простейшие). Новое, третье царство живых организмов стали называть царством архей.

Второе открытие, последовавшее за открытием Брока, носило практический характер. Из Thermus aquaticus был выделен термостабильный фермент, способный катализировать удвоение ДНК при высокой температуре. Обнаружение этого фермента способствовало развитию новой, эффективной и быстрой технологии, позволяющей изучать гены любых организмов. Эта новая технология позволяет многократно увеличить объем генной информации, извлекаемой из природных источников, а на ее основе возник многомиллионный рынок, связанный с использованием ДНК для диагностики и судебной экспертизы.

Третье открытие было сделано в результате изучения генома архей. Анализ генов архей дал ключ к пониманию того, как возникли наши собственные предки-эукариоты примерно 2 млрд лет тому назад. До сих пор в ДНК человека и всех других эукариот присутствуют многие фрагменты ДНК этих примитивных организмов. Эти общие для всех фрагменты текста представляют собой следы тех ранних событий, которые привели к появлению первого эукариота, и доказывают, что архея была одним из наших генетических родителей.

В этой главе мы исследуем несколько самых старых ДНК-текстов на Земле. Примечателен сам факт, что эти древние тексты устояли перед вечностью и не поддались бесконечному воздействию мутаций. Кроме того, существование этих «бессмертных» генов также является веским подтверждением двух ключевых элементов эволюционного процесса — способности естественного отбора сохранять информацию, заключенную в ДНК, и происхождение всех форм жизни от общего предка.

Бессмертные гены стали живым доказательством одного важного, но несколько недооцененного аспекта естественного отбора. Ученые больше внимания уделяли «созидательной» роли естественного отбора и возникновению новых признаков, но это лишь одна сторона эволюционного процесса. Помимо этого, естественный отбор удаляет, говоря словами Дарвина, «вредные изменения». Я объясню, каким образом удаление вредных мутаций под действием естественного отбора проявляется на уровне ДНК в виде сотен генов, сохранившихся во всех царствах живых организмов на протяжении 2 млрд лет.

Эти бессмертные гены отражают эволюционный «бег на месте», поскольку текст ДНК изменяется только в узких пределах, определенных естественным отбором.

Сохранение отдельных генов на протяжении целых геологических эпох — это не только бесспорное доказательство защитной функции естественного отбора. Эти гены — ключ к пониманию того, как шла эволюция живых существ от их древних предшественников; это новый тип доказательств, который Дарвин не мог себе и представить. Я покажу, что эти бессмертные гены являются бесценными записями, отражающими степень родства между царствами и помогающими нам восстановить ход истории, которую нельзя проследить по окаменелостям.

Изучаем ДНК и читаем генетический код

Известные нам сегодня последовательности ДНК составляют 40 тыс. томов, по миллиону знаков в каждом. Генетическое содержание некоторых видов, например человека, образует целую энциклопедию из 3000 томов, а других, таких как бактерии, укладывается всего в три или четыре тома. Вне зависимости оттого, какой том мы раскроем, мы увидим одинаковый с виду текст, примерно такой:

ACGGCTATGGGCTACCAAGGGCTACCAACTACCAAAGTTACGGCTAATCGACATAATTGGCTACCAAGACATAACCTGGCTACCAATTACTATGGACGGCCTACGGCGTCCGCTAATAATCGACATAACCTTTACTATGGCTACCAAAGTGACATAACCTTTACTCATAACCTGGCTACCAACCAAGGGCTACCAACTACCAAAATTACTATGGGACATTAATCGACATAACCTTTACTAACCTGGCTACCAATTACTATGGACGGCCAATGG.

И так многие сотни страниц.

Как такой монотонный текст, составленный всего из четырех знаков, может кодировать инструкции, необходимые для создания сложных существ? Более того, как вообще можно прочесть эту бессмыслицу?

Чтобы понять язык ДНК, нужно научиться расшифровывать гены и геномы с помощью генетического кода. Это позволит нам сравнивать виды организмов с разной степенью родства — от ближайших до очень дальних родственников, чьи пути разошлись на самых ранних этапах эволюции. Осознание того, как работает эволюция, возникает тогда, когда мы начинаем понимать значение общности и различий между организмами.

Чтобы летопись ДНК помогла понять ход естественной истории, нужно твердо овладеть языком ДНК и механизмом организации живых систем на основании заключенной в ДНК информации. Не волнуйтесь, научиться понимать язык ДНК не так уж трудно. У нее очень простой алфавит, весьма ограниченный набор слов и простые правила грамматики. Вознаграждение за ваши труды — способность видеть и понимать процесс эволюции на самом фундаментальном уровне. Я согласен, что в новых терминах порой трудно разобраться, поэтому советую отметить этот раздел закладкой и при необходимости к нему возвращаться.

Итак, начнем.

Белки — это молекулы, которые в каждом организме выполняют все виды работ: они переносят кислород, формируют ткани и копируют ДНК для передачи следующему поколению. ДНК каждого вида организма содержит в себе специфические инструкции (в виде кода), необходимые для построения этих белков.

ДНК состоит из двух нитей, образованных основаниями четырех типов. Основания, эти химические кирпичики ДНК, обозначают буквами A, C, G и T. Нити ДНК удерживаются между собой за счет прочных химических связей, образующихся между парами оснований на двух нитях: A всегда образует пару с T, а C — с G, как показано на рисунке:

Если нам известна последовательность одной нити ДНК, по ней можно воссоздать последовательность противоположной нити. Инструкции для построения каждого белка задаются уникальной последовательностью оснований ДНК (TCGATAA и т. д.). Удивительно, но все разнообразие жизни на планете обеспечивается перестановками лишь этих четырех оснований. Таким образом, чтобы понять это разнообразие, мы должны расшифровать генетический код.

Как строятся белки и как они понимают, в чем заключается их функция? В роли строительных кирпичиков белков выступают аминокислоты. Каждая аминокислота кодируется последовательностью трех оснований ДНК, или триплетом (ACT, GAA и т. д.). Химические свойства этих аминокислот, соединенных в длинные цепи (средний белок состоит примерно из 400 аминокислотных остатков), определяют уникальное действие каждого белка. Фрагмент ДНК, кодирующий отдельный белок, называется геном.

Связь между кодом ДНК и последовательностью белка была установлена примерно 40 лет назад, когда биологи расшифровали генетический код. Декодирование ДНК и построение белка осуществляются в два этапа. На первом этапе последовательность оснований одной нити ДНК транскрибируется в последовательность РНК, называемую матричной (или информационной) РНК (мРНК). Затем, на второй стадии, мРНК транслируется в аминокислотную последовательность, из которой формируется белок. В клетках генетический код считывается (с транскрипта мРНК) триплетами, каждый из которых определяет одну аминокислоту (короткий пример представлен в правой части рис. 3.2).

Рис. 3.2. Экспрессия ДНК. Схематичное изображение основных стадий превращения ДНК в функциональный белок. Слева изображена длинная последовательность ДНК, содержащая несколько генов. Далее — экспрессия части одного из генов, происходящая в две стадии. Сначала одна из нитей ДНК транскрибируется в последовательность мРНК. Затем последовательность мРНК транслируется в белок, причем последовательность трех оснований в мРНК (триплет) кодирует одну аминокислоту в белке (здесь аминокислоты обозначены буквами L, N, P и O). В молекуле мРНК вместо основания T используется основание U. Рисунок Лианн Олдс.


Существует 64 разных триплета, образуемых комбинациями оснований A, C, G и T в ДНК, но аминокислот в составе белков всего 20. Это означает, что одну и ту же аминокислоту кодирует несколько триплетов (три триплета не кодируют ничего, а обозначают окончание перевода мРНК в последовательность белковой цепи, как точка обозначает конец предложения). Для нас вами очень удобно (и имеет огромное эволюционное значение), что этот код, за несколькими небольшими исключениями, один и тот же для всех видов организмов (вот почему для получения человеческих белков, таких как инсулин, можно использовать бактерии).

Таким образом, зная специфическую последовательность ДНК, можно определить закодированную в ней последовательность белка. Однако не вся последовательность ДНК кодирует белки. Достаточно большая доля ДНК является «некодирующей». Первая проблема, с которой сталкиваются ученые при расшифровке длинной последовательности ДНК, состоит в определении начала и конца «кодирующей» области. К счастью, теперь эту задачу решают на компьютерах с помощью специальных алгоритмов, которые отлично ищут и находят «иголки» в «стогах» ДНК.

Кодирующая последовательность среднего гена состоит примерно из 1200 оснований. У некоторых видов организмов, в частности у бактерий или дрожжей, тысячи генов упакованы очень плотно и разделены сравнительно короткими промежутками некодирующей ДНК. У человека и многих других сложных существ гены составляют лишь небольшую долю всей ДНК и разделяются протяженными некодирующими участками. Какие-то из этих участков нужны для регуляции функций генов, а остальные называют мусорной ДНК. Эта мусорная ДНК накапливается в геноме в результате действия нескольких механизмов и часто содержит длинные повторяющиеся участки, не несущие информации. Эти участки не удаляются из ДНК естественным отбором, если только не оказывают вредного воздействия. Я не буду долго рассказывать об этой ДНК, но не упомянуть о ней нельзя, поскольку она составляет заметную часть нашего генома — как открытое море, разделяющее группы островов (гены).

Судьбы генов. Бессмертное ядро

При анализе целого генома сначала требуется определить локализацию каждого гена в последовательности ДНК. Это позволяет провести инвентаризацию генов данного организма, а именно определить общее число генов и составить список всех генов. Поскольку такая работа проводится уже на протяжении какого-то времени, теперь имеется возможность рассортировывать гены и белки по категориям в зависимости от их функций и сходства с уже известными генами и белками.

При сравнении геномов разных организмов выяснилась удивительная вещь: хотя количество генов и их виды значительно различаются у представителей разных царств и даже внутри одного и того же царства, усложнение организма не сопровождается пропорциональным увеличением количества генов. Как показано в табл. 3.1, у большинства бактерий в среднем около 3 тыс. генов, а самые маленькие геномы свободноживущих видов содержат около 1600 генов. Однако геномы некоторых видов бактерий различаются очень сильно — примерно на 3 тыс. генов. Животные имеют примерно от 13 тыс. до 25 тыс. генов, причем геномы некоторых видов отличаются по размеру на тысячи генов. Такое сложное существо, как плодовая мушка, имеет лишь примерно в два раза больше генов, чем одноклеточные пивные дрожжи, а у человека почти в два раза больше генов, чем у плодовой мушки. Зато у человека и у мыши количество генов почти одинаковое.


Таблица 3.1. Количество генов в геноме некоторых организмов

Однако количество генов — всего лишь общая цифра. Более подробную информацию о ходе эволюции мы получим, если сравним судьбы индивидуальных генов. Различие в количестве генов говорит о том, что какие-то гены, присутствующие в одном организме, отсутствуют в другом. Но, прежде чем приступить к специфическим сравнениям, подумаем о том, что можно обнаружить при сравнении генов организмов, относящихся к разным видам. Какого сходства или различия мы должны ожидать?

В середине XX в., до появления технологии секвенирования ДНК, многие биологи-эволюционисты задавали себе этот вопрос. Они кое-что знали о мутациях и считали, что через длительный период времени мутации должны привести к изменению практически всех оснований ДНК в геноме. Например, при частоте мутаций 1:100 млн пар оснований в каждом поколении через 100 млн поколений большинство позиций в каждом гене подвергнутся мутации хотя бы один раз. Учитывая очень малое время генерации микробов (несколько часов) и небольшое время генерации растений и мелких животных (не более года), не стоит ожидать особого сходства между генами любых двух видов, отделившихся от общего предка 100 млн лет назад. В 1963 году в книге «Зоологический вид и эволюция» (Animal Species and Evolution) известный биолог Эрнст Майр заметил: «Многое из того, что мы узнали о физиологии генов, доказывает, что поиск гомологичных генов [одинаковых генов в разных видах организмов] является довольно бесполезным занятием, за исключением самых близкородственных видов».

Но на самом деле, если сравнить между собой разные виды бактерий и разные виды животных, которые отделились от общего предка свыше 100 млн лет назад, мы обнаружим в их генах огромное сходство. Например, если сравнить геном печально знаменитого деликатеса рыбы фугу с геномом неразумного гурмана, человека, поглощающего эту рыбу, то выяснится, что не менее 7350 генов у этих двух видов являются общими. Более того, последовательности кодируемых этими генами белков совпадают примерно на 61 %. Поскольку пути эволюции рыб и других позвоночных, включая человека, разошлись примерно 450 млн лет назад, столь значительное сходство вряд ли могло бы сохраниться, если бы мутации просто накапливались со временем.

Еще более удивительно, что при сравнении геномов архей, бактерий, грибов, растений и животных было найдено около 500 генов, которые присутствуют во всех организмах. Как показывает анализ окаменелостей, эукариоты появились не менее 1,8 млрд лет назад, а археи и бактерии — более 2 млрд лет назад. Те гены, которые являются общими для этих организмов, на протяжении 2 млрд лет выдерживали непрерывный поток мутаций, но их последовательность и содержание почти не изменились, несмотря на все различия между их хозяевами. Это и есть бессмертные гены.

Бессмертные гены играют важнейшую роль в основополагающих универсальных процессах в клетке, таких как перевод ДНК в РНК и РНК в белок. Все виды организмов зависят от этих генов со времен появления сложных форм жизни на Земле. Эти гены сохранялись чрезвычайно долгое время, и будущая эволюция всех форм жизни также будет зависеть от этого «бессмертного ядра».

Эти гены дошли до наших дней не потому, что избежали мутаций, — они подвержены им в той же степени, что и все остальные гены. Они бессмертны, поскольку сохраняют свою идентичность («остаются собой»), но при этом некоторые основания в их последовательности все же изменяются. Это хорошо видно, если внимательно проанализировать последовательность ДНК этих генов и соответствующую ей последовательность белка, и именно на этом материале можно продемонстрировать одну из особенностей естественного отбора.

Бег на месте: консервативность естественного отбора

При внимательном рассмотрении выясняется, что последовательности ДНК бессмертных генов в разных видах организмов различаются сильнее, чем синтезируемые на их основании белки. Это расхождение связано с так называемой вырожденностью генетического кода: одну и ту же аминокислоту могут кодировать разные триплеты. Эта особенность генетического кода способствует тому, что далеко не все мутации, изменяющие основания ДНК, изменяют последовательность белка. Мутации ДНК, не влияющие на «смысл» триплета, называют синонимичными, поскольку исходные и мутированные триплеты кодируют одну и ту же аминокислоту. Мутации, изменяющие смысл триплетов и приводящие к замене одной аминокислоты на другую, называют несинонимичными мутациями.

Можно рассчитать вероятность появления синонимичных и несинонимичных мутаций. Всего существует 64 варианта триплетов. В каждом положении каждого триплета возможны три варианта замены, то есть всего девять мутаций в каждом триплете. Умножая 64 на девять, получаем 576 возможных случайных мутаций оснований в триплетах. Анализ генетического кода показывает, что 135 из 576 мутаций (примерно 23 %) являются синонимичными, а остальные 77 % — несинонимичными. Основной вывод, который следует из этого расчета, заключается в том, что без вмешательства естественного отбора соотношение несинонимичных и синонимичных мутаций в ДНК составляет примерно 3:1 (77:23).

Однако в природе это соотношение обычно составляет 1:3 в пользу синонимичных мутаций. Это соотношение в десять раз меньше того, которого следовало бы ожидать при случайном накоплении мутаций. Лишь небольшая доля возникающих несинонимичных мутаций остается в популяции. Какой же фактор так сильно ограничивает распространение несинонимичных мутаций?

Ответ только один: естественный отбор. Такое изменение соотношения является прекрасным доказательством действия так называемого очищающего отбора, который поддерживает «чистоту» аминокислотных последовательностей, избавляя белки от мутаций, которые могли бы повлиять на их функцию.

Влияние очищающего естественного отбора можно обнаружить в последовательностях большинства генов, но наиболее ярко оно выражено в бессмертных генах, сохранившихся во всех царствах живых организмов. Например, многие белки, участвующие в трансляции мРНК, являются общими у всех видов. Если взглянуть на фрагмент хотя бы одного из этих белков у представителей архей, бактерий, растений, грибов и животных, можно увидеть значительное сходство, не утраченное за 2 млрд лет (рис. 3.3; для простоты все аминокислоты обозначены буквами). Обратите внимание, что в ходе эволюции у разных видов сохранилось 14 одинаковых аминокислотных остатков. Эти 14 букв являются бессмертными.

Рис. 3.3. Бессмертные гены. Короткий фрагмент последовательности белка (так называемого фактора элонгации 1-а), обнаруженного во всех царствах жизни. Некоторые аминокислоты (выделены серым цветом,) не изменились на протяжении миллиардов лет. Рисунок Джейми Кэрролл.


Однако, если мы сравним последовательности ДНК, кодирующие этот фрагмент в данных организмах, мы обнаружим, что они различаются в значительно большей степени. Например, анализ соответствующих генов людей и томатов показывает, что они совпадают лишь по 65 из 78 позиций (83 %), тогда как белки идентичны по 25 из 26 позиций (96 %). Причина большего сходства белковых последовательностей по сравнению с последовательностями ДНК заключается в наличии в ДНК 12 синонимичных замен, то есть замен, которым разрешено накапливаться.

Эволюция генов в условиях очищающего отбора — своеобразный «бег на месте». Это означает, что основания могут изменяться, но смысла это не меняет. Рассмотрим, например, триплет TTA, кодирующий аминокислоту лейцин. Этот триплет может измениться двумя разными способами, но при этом по-прежнему будет кодировать лейцин, а мутированные триплеты могут измениться еще раз, но все еще будут кодировать лейцин.

Большинство аминокислот кодируются по меньшей мере двумя разными триплетами, а некоторые аминокислоты — тремя и большим числом триплетов (в случае лейцина их шесть). Таким образом, триплеты в последовательностях ДНК могут «бегать» (изменяться), однако естественный отбор постоянно следит за ними и не позволяет им «убежать» настолько далеко, чтобы это привело к изменению последовательности или функции белка.

Предотвращение слишком сильных изменений происходит за счет того, что естественный отбор благоприятствует сохранению одной конкретной последовательности по сравнению с вариантами, в которых изменена одна или несколько аминокислот. Если какой-то вариант белка функционирует хуже остальных, пусть даже на 0,001 %, со временем естественный отбор (по тем математическим законам, о которых мы говорили в предыдущей главе) вычищает этот вариант из большой популяции. Эти чистки настолько эффективны, что отдельные «буквы» в «тексте» белка могут сохраняться в неизменном виде практически у всех видов организмов. Представьте себе: бессмертные буквы в белковых последовательностях бесконечно, снова и снова подвергаются мутациям в множестве особей, у миллионов видов, на протяжении миллиардов лет — но все эти мутации вновь и вновь отметаются естественным отбором.

Выравнивание белковых последовательностей (рис. 3.3) показывает, что существуют ограничения в выборе аминокислотных остатков для данного белка и что белковые последовательности разных видов различаются лишь по нескольким позициям. Синонимичные мутации допускаются гораздо чаще, чем несинонимичные. Я показал это на фрагменте лишь одного гена, но я мог бы привести в пример тысячи генов, включая 500 бессмертных генов и многие-многие другие гены из любой группы организмов. Строгое сохранение большинства позиций в белковых последовательностях при синонимичной эволюции соответствующих последовательностей ДНК и изменение лишь ограниченного числа аминокислотных позиций — это важнейшая закономерность эволюционного процесса на уровне ДНК.

Последовательности ДНК, которые кодируют один и тот же белок, но при этом существенно отличаются друг от друга — бесспорное свидетельство работы отбора, допускающего мутации, которые не влияют на функции белка, и отсеивающего мутации, которые их изменяют. Таким образом, сохранение общих генов у различных видов организмов на протяжении длительного времени является решающим доказательством одного из аспектов естественного отбора — его способности, говоря словами Дарвина, уничтожать вредные изменения.

Однако эволюционирующие геномы не просто несут на себе следы естественного отбора. В летописи ДНК отражена не только история конкретного гена, но и информация о его носителях, современных и тех, что давно вымерли. Благодаря способности отбора хранить информацию, которая в противном случае должна была бы со временем исчезнуть, геномы рассказывают историю жизни на Земле. Новые данные, полученные из геномов, позволяют заглянуть в глубокое прошлое — такой возможности не давали никакие другие источники. Я завершу эту главу рассказом об эволюции того домена, к которому принадлежим мы с вами (домен эукариот), а также о том вкладе, который внесли в развитие наших предков-эукариот архей и бактерии.

Появление эукариот: союз двух непохожих родителей?

Я верю, что придет время, хотя я и не доживу до тех пор, когда у нас будет истинное генеалогическое древо для каждого царства живых организмов.

Чарльз Дарвин Из письма Т. Хаксли, 26 сентября 1857 г.

Со времен Дарвина наше понимание устройства природы значительно продвинулось вперед. Раньше всю живую природу подразделяли лишь на царство растений и царство животных. Эта двоичная система существовала со времен Аристотеля и была формально описана Карлом Линнеем в 1735 г. В 1866 году Эрнст Геккель, осуществивший замечательное исследование простейших организмов, добавил к этой классификации третье царство — царство протистов. Бактерии и грибы были включены в классификацию в качестве полноправных царств только в начале XX в.

Кроме распределения по пяти царствам признавалось и разделение более высокого порядка, основанное на фундаментальном различии клеток, обнаруженных у представителей разных царств. В 1938 году французский биолог Эдуард Шатон предложил называть представителей этих «надцарств» прокариотами и эукариотами в зависимости от присутствия или отсутствия ядра в их клетках. В эти надцарства попадали все известные формы живых организмов, но лишь до тех пор, пока Карл Воуз не начал изучать гены организмов, обнаруженных Томом Броком в Йеллоустоне.

Воуз считал, что таксономия бактерий слишком запутанна и что для определения эволюционных связей между видами требуются более объективные показатели, чем их морфология или физиология. Он обратился к изучению молекул. Как только анализ белковых последовательностей стал выявлять сходство и различия между белками, общими у разных видов, многие ученые (такие как Фрэнсис Крик, Эмиль Цукеркандль и Лайнус Полинг) признали, что можно строить генеалогическое древо живых организмов на основании последовательностей ДНК, РНК и белков. В основе этого подхода лежала очень простая идея. Участки в последовательности ДНК, РНК или белков, различающиеся у одних групп видов, но одинаковые у других, указывают на степень родства этих видов. Так же как семейное древо строится на основе степеней родства, генеалогическое древо живых организмов строится на основе генетического сходства. Однако, как я объясню далее, иногда случаются такие союзы, которые в немалой степени запутывают семейную генеалогию.

Для создания генеалогического древа бактерий Воуз использовал имеющийся в изобилии тип молекул РНК. Однако, когда он включил в свою схему термофильные метанобразующие организмы, оказалось, что «эти „бактерии“ похожи на типичные бактерии не больше, чем на эукариотическую цитоплазму». Он предположил, что существует третье надцарство, куда следовало бы отнести эти организмы, приспособленные к жизни в различных экстремальных условиях. Поскольку считается, что именно такие условия существовали на Земле в самом начале ее истории, это царство могло бы считаться первичным, или процарством, так что Воуз предложил назвать это надцарство «архебактериями». Позднее архебактерии стали называть археями, отчасти чтобы не путать их с бактериями, а «надцарства» переименовали в «домены».

Хотя разделение всех форм жизни на три домена — эукариоты, архей и бактерии — закрепилось в науке, в родственных связях между ними оказалось не так-то просто разобраться. По представлениям Дарвина каждая ветвь генеалогического древа жизни соответствовала образованию нового вида. Однако в мире микробов, с которым Дарвин не был знаком, происходят события, нарушающие стандартный способ ветвления. Микробы могут обмениваться генами, а некоторые микробы живут внутри других организмов-хозяев (так называемый эндосимбиоз). И то и другое способствует переносу генов между очень отдаленными видами организмов и нарушает «правильное» ветвление генеалогического древа. Чтобы понять связь между эукариотами, археями и бактериями, биологи должны установить происхождение множества генов, далеко не все из которых могут иметь признаки семейного сходства.

Например, в ранних исследованиях было обнаружено удивительное сходство между некоторыми молекулами архей и молекулами эукариотов. Белки, которые археи используют для упаковки ДНК в хромосомы, транскрипции ДНК и расшифровки генетической информации, настолько похожи на соответствующие белки эукариот, что высказывалось предположение о том, что эукариоты произошли от каких-то видов архей. Это сходство, в частности, присутствует в коротких специфических последовательностях («подписях») в составе белков, которые являются общими для некоторых архей и эукариот, но отсутствуют в других группах организмов. Например, в одном из бессмертных белков, участвующих в расшифровке генетической информации, есть короткая вставка из и аминокислотных остатков. В таблице 3.2 представлена последовательность этой вставки у различных эукариот и архей.


Таблица 3.2. Последовательность вставки

Присутствие этой последовательности в двух доменах и ее отсутствие в третьем логично было бы объяснить тем, что архей и эукариоты более близкие родственники друг другу, чем бактериям. Если строить древо жизни исходя из этого соображения, то получается, что общий предшественник всех трех доменов (так называемый последний общий универсальный предшественник, LUCA — от англ. last universal common ancestor) в какой-то момент дал начало двум доменам — бактериям и археям, а позднее от ветви архей отделились эукариоты. В этом случае древо жизни имело бы такой вид, как изображено на рис. 3.4.

Рис. 3.4. «Традиционная» форма древа жизни. Все домены возникают как ветви на стволе дерева. Рисунок Джейми Кэрролл.


Однако в результате секвенирования целых геномов архей и бактерий довольно неожиданно обнаружилось, что очень многие гены архей похожи на соответствующие гены бактерий. Затем по мере расшифровки все большего числа эукариотических геномов стало выясняться, что многие гены эукариот ближе к генам бактерий, чем к генам архей. Возникла ситуация как в известной загадке: «Если твоя сестра приходится тебе тетей, то кто твой отец?» Одним словом, ответить на вопрос о том, кто кому более близкий родственник, оказалось совсем не просто.

Ответ был найден в результате дополнительных исследований. Было замечено, что основное сходство между генами архей и эукариот касается так называемых информационных генов, продукты которых участвуют в удвоении и экспрессии ДНК. А наибольшее сходство между генами эукариот и бактерий обнаружено в операционных генах, отвечающих за метаболизм различных питательных веществ и основных клеточных компонентов. Это могло означать, что эукариоты взяли «ум» (информационные гены) от одного родителя, а «внешность» (операционные гены) — от другого;

Отсюда родилось подозрение, что эукариоты являются плодом смешанного союза — генетического слияния архей и бактерий. Идея о слиянии сильно различающихся видов не является новой. В 1970 году Линн Маргулис[11] предположила, что митохондрии и хлоропласты — две основные производящие энергию клеточные органеллы в эукариотических клетках — происходят из бактерий, живущих внутри эукариот (этот процесс называется эндосимбиозом). Сегодня эта точка зрения широко распространена.

Но правда ли, что эукариоты произошли от союза архей и бактерий? Мария Ривера и Джеймс Лейк из Калифорнийского университета в Лос-Анджелесе пришли к выводу, что эукариоты и в самом деле имеют двоякую природу, то есть происходят от родителей, находящихся на разных ветвях древа жизни. Ривера и Лейк анализировали геномы бактерий, архей и эукариотов в поисках групп генов, имеющихся абсолютно во всех основных подразделах этих трех доменов, а также генов, отсутствующих в одном, двух, трех и т. д. из этих подразделов. Всесторонний анализ распределения общих генов показывает, что геном эукариот является продуктом слияния геномов каких-то видов архей и каких-то видов бактерий. Симбиотические взаимоотношения достаточно часто встречаются у живущих вместе организмов (так, Thermus aquaticus из горячих источников в Йеллоустоне получает энергию от фотосинтезирующих цианобактерий, которые и придают окраску почве вокруг источников), и время от времени это приводит к эндосимбиозу, поэтому возможным объяснением происхождения эукариот является слияние геномов эндосимбионта и его хозяина. Таким образом, основание древа жизни — это не точка, а круг, из которого наше древо восходит и разветвляется (рис. 3.5).

Рис. 3.5. Новое изображение филогенетического древа эукариот. Анализ ДНК показывает, что эукариоты появились в результате слияния каких-то видов архей с какими-то видами бактерий. Таким образом, основанием древа является круг, а не точка. Из статьи M. Rivera, J. Lake, 2004, Nature 431:152 (с изм.).


Поэтому, если вам повезет и вы посетите замечательный парк в Йеллоустоне, не отворачивайтесь от кипящего в горячих источниках неприятно пахнущего супа и сдержите свое отвращение при виде ярко окрашенной тины. Это невежливо по отношению к родственникам, пусть даже самым дальним. Обдумайте тот забавный факт, что вас с представителями этого сообщества роднят сотни общих генов. И именно в этом сообществе, когда-то безумно давно, возможно, где-то в глубоководных термальных источниках, из столба метана возник предок всех существующих на Земле живых организмов.

Конечно, если бы естественный отбор сводился к поддержанию порядка в очень жестких пределах, жизнь была бы однотипной и неизменной и не имела бы того бурного разнообразия форм, которое мы видим вокруг и в летописи окаменелостей за последние 3 млрд лет. Данные, приведенные в табл. 3.1, говорят о том, что геномы разных видов очень сильно различаются. Если оставить в стороне 500 общих бессмертных генов, геномы различаются как по количеству генов, так и по последовательностям. Различие в количестве генов говорит о том, что в ходе эволюции должны были возникать новые гены. Они и вправду возникали — это созидательное измерение эволюции станет темой следующей главы. Но раз гены рождаются, они могут и умирать. Это тоже верно — гены умирают, и о том, что это значит для эволюции, мы поговорим в пятой главе.

Обезьяна колобус в парке Кибале (Уганда). Эта обезьяна способна находить более питательные листья и переваривать их благодаря двум эволюционным приобретениям — полноценному цветовому зрению и специфической системе пищеварения, напоминающей систему пищеварения жвачных животных. Фотография Кагана Секерсиоглу.

Глава 4 Сделать новое из старого

Сохраняй старое, но познавай новое.

Китайская пословица

В парке Кибале время завтрака.

Высоко под куполом леса стая нарядных черно-белых колобусов перебирается на новое место в поисках пищи. Можно предположить, что рацион питания этих обитателей густых дождевых лесов Уганды будет бесконечно разнообразен. Однако колобусы не обращают никакого внимания на изобилие зелени и выбирают растения с красноватыми листьями. Единственный вид обезьян, у которых нет большого пальца (их название происходит от греческого слова kolobus, что означает «искалеченный» или «обрубленный»), колобусы направляют в рот гибкие ветви с молодыми листьями, ловко работая своими четырьмя пальцами.

Чуть ниже, ближе к земле, несколько особей из пяти сотен обитающих здесь шимпанзе с криками пробираются к фиговым деревьям. Они тоже иногда жуют листья, но по-настоящему их интересуют только спелые красные или желтые плоды. Шимпанзе не любят неспелые фрукты, поэтому они срывают несколько плодов на пробу, удобно усевшись на ветке.

Для поиска пищи колобусы и шимпанзе пользуются своим полноценным цветовым зрением, которое отсутствует у млекопитающих, не относящихся к приматам. Все обезьяны Старого Света (африканские и азиатские), включая человекообразных обезьян, обладают трихроматическим зрением, которое позволяет им различать цвета во всем видимом спектре — от синего до красного. Большинство других млекопитающих имеют дихроматическое зрение, то есть могут видеть синий и желтый цвет, но не отличают красный от зеленого. Обладание трихроматическим зрением играет очень важную роль, поскольку наиболее нежными и питательными являются молодые листья, а в тропиках более чем у половины растений они окрашены в красный цвет. Используя это различие в цвете, невидимое для других листоядных животных, приматы собирают самые питательные листья.

Переваривать лиственный завтрак колобусам помогает уникальная способность, которой обладают только они и их ближайшие родственники — в отличие от шимпанзе и всех остальных приматов. Колобусы — жвачные животные! Они могут питаться листьями и травой, поскольку располагают необычайно большим желудком с множеством камер. Взрослые особи с массой тела около 15 кг съедают ежедневно около 3 кг листьев, и от этого у них образуется весьма заметный животик. Бактерии в кишечнике колобуса помогают переварить растительную пищу, пока она медленно продвигается по пищеварительному тракту, а особые ферменты позволяют расщепить важнейшие питательные вещества, высвобождаемые бактериями.

Зрение и пищеварительная система этих приматов заставляют вновь задаться одним из величайших вопросов биологии: как у живых организмов появляются новые признаки? В этой главе мы рассмотрим механизмы, которые позволяют живым организмам приобретать новые способности и развивать старые таланты. Мы узнаем о том, как новые функции и новые гены возникают из «старых» генов. Я расскажу, как случайное удвоение гена обеспечивает запчасти для эволюции новых функций и как эти новые и старые части генома настраиваются для адаптации к определенному образу жизни.

Я мог бы привести множество примеров нововведений и модификаций. Однако я в основном буду рассказывать о происхождении и эволюции цветового зрения, и для этого есть несколько веских причин. Во-первых, преимущества этой способности очевидны. Во-вторых, зрительные системы животных, обитающих в самых разных условиях (в океанах, саваннах, лесах, пещерах, под землей и т. д.), поразительно адаптированы именно к этим конкретным условиям. В-третьих, мы достаточно хорошо знаем биологию и физику процессов, лежащих в основе цветового зрения, и поэтому можем оценить большие и малые различия в зрительных способностях живых организмов и в том, какие цвета они могут воспринимать. Мы знаем, что существует широкий ультрафиолетовый диапазон спектра, который невидим для человека, но птицы, насекомые и многие другие живые существа используют его для поиска пищи, партнеров и сородичей. В-четвертых, гены, отвечающие за цветовое зрение, возможно, изучены лучше, чем гены, отвечающие за какие-либо другие функции. Все вместе дает нам колоссальный объем знаний, позволяющий связать различия между определенными генами с различиями в экологии и эволюции видов.

Новые научные данные, с которыми мы познакомимся в этой главе, служат ясным и прямым доказательством трех аспектов эволюции — естественного отбора, полового отбора и происхождения видов путем наследования с изменениями. Эти три аспекта отчетливо проявляются при анализе хода эволюции по генетическим данным. Чтобы проследить этапы эволюции, нам придется идентифицировать важные различия между отдельными видами, определить, когда эти различия возникли, и описать, как те или иные изменения на уровне ДНК влияют на природные особенности организмов. Для этого нам нужны два типа данных, полученных из ДНК. Во-первых, чтобы узнать, когда и в каких видах произошли изменения, мы обратимся к недавно обнаруженным уникальным последовательностям ДНК, что позволит нам получить четкую картину взаимосвязей между видами. Во-вторых, нам придется тщательно проанализировать ДНК-код тех генов, которые отвечают за цветовое зрение. В последовательностях этих генов запечатлены следы естественного отбора.

Журналист Рекс Дальтон писал о мире, который видят птицы, но не видим мы: «Если вы хотите узнать мысли животных, посмотрите на мир их глазами». Я начну с того, что объясню, как животные различают цвета, а затем мы с вами проследим ход эволюции при помощи этих самых глаз.

Рассматриваем радугу

Зрение человека уникально. Мы различаем цвета и их оттенки благодаря группе тонко настраиваемых молекул, которые распознают свет в клетках нашей сетчатки и посылают сигналы в головной мозг. У других животных набор этих молекул иной, или они настроены на восприятие других частей спектра (а возможно, и то и другое). Чтобы понять, что же видим мы и другие животные, нам нужно кое-что узнать о свете и цвете, о молекулах, которые детектируют свет, и о клетках глаза, собирающих цветовое изображение.

Наши глаза очень чувствительны к тому диапазону спектра, который мы, с нашей антропоцентрической точки зрения, называем видимым светом. На самом деле это узкая полоска в широком спектре электромагнитного излучения. Белый цвет является результатом смешения всех цветов видимого диапазона спектра, простирающегося от фиолетового до синего, зеленого, желтого, оранжевого и красного. Каждому цвету радуги соответствует определенная длина волны: фиолетовый свет имеет длину волны около 400 нанометров (нм), а красный — около 700 нм (рис. 4.1).

Рис. 4.1. Спектр видимого света. Фиолетовый, синий, зеленый и красный свет — это свет с разной длиной волны (измеряется в нанометрах, нм). Цветовое зрение человека настроено на восприятие света с четырьмя разными длинами волн (указаны стрелками,) с помощью четырех разных белков опсинов. Рисунок Лианн Олдс.


Цвет предметов зависит от длины волн поглощенного или отраженного света, а это, в свою очередь, определяется молекулярной структурой этих предметов. Например, траву мы видим зеленой, поскольку она поглощает свет во всем диапазоне видимого спектра, кроме зеленого; зеленый свет с длиной волны 520 нм трава отражает. Небо кажется нам голубым, поскольку атмосфера рассеивает волны солнечного света, большинство которых голубые. Оставшаяся часть солнечного света кажется желтой, поскольку так выглядит белый цвет, если из него вычесть синий. Закат мы видим оранжевым, поскольку при приближении солнца к линии горизонта свет проделывает более долгий путь через атмосферу, прежде чем достичь наших глаз, и по дороге рассеивается большая часть синего, в результате чего остается оранжевый цвет. В солнечном излучении есть и более коротковолновая составляющая, которую мы не видим, в частности ультрафиолетовое излучение, рассеиваемое атмосферным озоном. Та часть ультрафиолетового излучения, которая все же достигает земли, поглощается кожей и вызывает ожоги у таких бледнокожих представителей человечества, как я, а тех, кому повезло больше, чем мне, покрывает красивым загаром. Свет с большей длиной волны, как тот, что выделяется в виде тепла от горящего огня, называют инфракрасным излучением. Его тоже нельзя увидеть невооруженным глазом, но можно зарегистрировать с помощью очков ночного видения — специального устройства с детекторами инфракрасного излучения, которые реагируют на тепло.

Восприятие цвета начинается тогда, когда свет с определенной длиной волны сталкивается со зрительными пигментами в сетчатке глаза. Эти пигменты состоят из белка опсина и небольшой молекулы хромофора, которая у человека является производным витамина A. Чувствительность зрительного пигмента к свету определяется последовательностью белка опсина и его взаимодействием с хромофором. Это взаимодействие обеспечивает тонкую спектральную настройку, в результате которой каждый зрительный пигмент настраивается на свет с определенной длиной волны. У человека есть три вида зрительных пигментов, чувствительных к коротким, средним и длинным световым волнам. Их называют коротковолновыми, средневолновыми и длинноволновыми опсинами (или опсинами SWS, MWS и LWS). Опсин SWS настроен на длину волны 417 нм (синий цвет), опсин MWS — на 530 нм (зеленый цвет), а опсин LWS — на 560 нм (красный цвет), и вместе они обеспечивают нам цветовое зрение. Четвертый пигмент, родопсин (497 нм), используется в основном при слабом освещении. Свет с длиной волны меньше 400 нм (ультрафиолетовая область) или больше 700 нм (инфракрасная область) невидим для человека, но, как я расскажу позднее, многие животные могут видеть в ультрафиолетовом диапазоне спектра.

Глаз человека снабжен двумя типами фоторецепторных клеток — палочками и колбочками, которые получили свое название благодаря форме своих внешних частей, содержащих зрительные пигменты (рис. 4.2).

Рис. 4.2. Восприятие цвета сетчаткой человеческого глаза. Свет попадает в глаз через хрусталик, а затем достигает сетчатки. В сетчатке есть два типа фоторецепторных клеток: палочки, которые позволяют видеть при слабом освещении, но не создают цветовых изображений, и колбочки, содержащие опсины одного из трех видов (у человека), настроенные на восприятие красного (К), зеленого (3) или синего (С) цвета. Возбуждение палочек и колбочек интегрируется нейронами, которые соединяются в зрительный нерв. Далее зрительный нерв проводит сигнал к зрительным центрам головного мозга. Рисунок Лианн Олдс.


В целом палочки обладают очень высокой чувствительностью к свету и наиболее интенсивно используются ночью и при слабом освещении, но они не способны различать длину световой волны, поэтому ночью мы плохо различаем цвета. Колбочки используются при ярком свете, и именно с их помощью мы воспринимаем цвет.

Когда свет попадает на хромофор, он вызывает серию очень быстрых изменений зрительного пигмента. За тысячные доли секунды пигмент переходит в возбужденное состояние, что активизирует фоторецепторные клетки. В конечном итоге сигнал фоторецепторов сетчатки достигает зрительных центров коры головного мозга. Чтобы изображение было воспринято как цветное, должны возбудиться как минимум два типа колбочек. Цвет «видимых» мозгом предметов определяется относительным уровнем возбуждения каждого типа колбочек. Если в сетчатке присутствует лишь один тип колбочек, все будет видеться в серой цветовой гамме.

Каждый опсин кодируется отдельным геном. У шимпанзе и других обезьян имеются те же три опсина, что и у человека (SWS, MWS и LWS). Однако у большинства других млекопитающих есть лишь два опсина (и два соответствующих гена), а вот у птиц и рыб — четыре опсина и более. Таким образом, очевидно, что число генов опсинов изменялось в ходе эволюции животных. Эволюция генов опсинов шла через удвоение генов, которое является одним из важных механизмов повышения информационного содержания ДНК. В этом процессе последовательность существующего гена удваивается, а затем пути «старой» и «новой» копии расходятся, и они превращаются в отдельные гены с разными функциями.

Мы знаем, что с опсинами это происходило в ходе эволюции позвоночных животных, но нам хотелось бы знать больше, а именно, какие конкретно животные приобрели (или потеряли) гены опсинов. Недостаточно просто сказать, что два вида различаются между собой: чтобы проследить этапы эволюции, нужно иметь перед глазами картину того, что было до и что было после интересующего нас события. Чтобы узнать истинную историю генов опсинов, нам нужно хорошо представлять себе родственную связь между разными группами животных. Знание родственных связей между организмами позволяет понять направление эволюции конкретного признака и определить состояние этого признака и соответствующего гена у общих предков. Например, если два родственных вида имеют общий признак или общий ген, скорее всего, это не является совпадением, а объясняется тем, что их общий предок также обладал этим признаком или геном. Определить происхождение признака невозможно без знания генеалогии видов. Чтобы представить себе, как была установлена генеалогия видов, имеющих отношение к появлению нашего цветового зрения, нужно хотя бы в общих чертах понять, как сегодня, в эпоху ДНК, устанавливают родственные связи между видами. Я расскажу о недавно обнаруженных и очень важных последовательностях ДНК, которые позволяют реконструировать историю видов с небывалой доселе ясностью и достоверностью.

От молекул к деревьям

С тех пор как Дарвин предположил, что эволюционное развитие организмов можно представить в виде ветвящегося дерева, биологи все время рисуют подобные деревья для изображения родственных связей между ныне живущими и когда-то жившими организмами. Раньше подобные деревья строились на основании внешних признаков современных организмов или ископаемых остатков древних организмов. Однако довольно часто выяснялось, что внешнее сходство или его отсутствие уводит не в ту сторону или по меньшей мере вызывает споры между биологами, поэтому практически для всех основных групп организмов было создано несколько генеалогических деревьев.

Несколько десятилетий назад для определения степени родства между видами ученые начали использовать последовательности биологических молекул. Гены наследуются, и это означает, что последовательности генов и кодируемых ими белков передаются от родителей детям. Происходящие в этих последовательностях изменения также передаются потомкам на всем долгом пути эволюции. Таким образом, степень сходства ДНК может служить показателем близости родства между видами.

Теоретически для построения генеалогического древа биологи имеют в своем арсенале тысячи последовательностей ДНК или белков. На практике для выбора генов для построения древа используют несколько критериев отбора (в частности, стоимость анализа), так что обычно из многих генов-кандидатов выбирают лишь один или несколько. На основании выбранных последовательностей генов с помощью сложного математического и статистического аппарата строят генеалогическое древо. Это древо должно как можно точнее соответствовать имеющимся экспериментальным данным. Так как последовательности генов состоят всего из четырех знаков (A, C, G и T), при недостаточном количестве данных родство между организмами может быть определено неточно. Не следует думать, что с помощью любого гена можно получить один и тот же правильный или однозначный ответ. Поэтому один из способов проверить, насколько верно выстроено древо, — попытаться воспроизвести его на основании другой последовательности или более широкого круга последовательностей.

К счастью, был разработан совершенно новый метод определения родственных связей между видами. Он также основан на анализе ДНК, но учитывает не степень сходства последовательностей в целом, а наличие или отсутствие определенных маркеров в специфических участках ДНК. Эти маркеры возникают в результате случайного встраивания мусорной ДНК рядом с генами. Достаточно часто в ДНК встречаются специфические последовательности, называемые длинными диспергированными повторами (LINE) и короткими диспергированными повторами (SINE). Если такие повторы встраиваются в последовательность, они в ней остаются, поскольку не существует механизма их активного удаления. Последовательность этих элементов в составе ДНК является характерной для данного вида и передается по наследству всем потомкам. Это замечательный инструмент для построения генеалогического древа. Случаи встраивания подобных последовательностей встречаются очень редко, поэтому их присутствие в одном и том же участке ДНК двух разных видов может объясняться исключительно происхождением этих видов от общего предка. На том же принципе наследования маркеров в ДНК основано определение отцовства у людей. Анализ распределения нескольких маркерных элементов ДНК, возникших в разное время у разных организмов, дает биологам достаточно данных, чтобы абсолютно точно устанавливать родственные отношения между видами.

Мы вкратце ознакомились с сутью процесса построения генеалогического древа, но давайте не будем ставить точку. Мне хочется, чтобы, читая эту книгу, вы в полной мере оценили природу и качество имеющихся доказательств эволюции. Чтобы поверить и понять, нужно увидеть. Поэтому давайте посмотрим, как с помощью повторов SINE было построено такое важное генеалогическое древо, как древо человека и других приматов, а затем при помощи этого древа раскроем тайну происхождения цветового зрения.

Прежде всего при построении древа нужно обнаружить набор повторов SINE. Последовательность генома человека известна, что облегчает задачу: мы можем выбирать из тысяч коротких диспергированных повторов. В соответствующих участках ДНК других приматов ищут те же самые повторы.

Большинство SINE состоят примерно из 300 пар оснований, поэтому, если в ДНК какого-то организма содержится такой же SINE, как в ДНК человека, этот фрагмент ДНК будет на 300 пар оснований длиннее, чем в случае отсутствия SINE. На рис. 4.3 представлены данные, полученные Абдель-Халимом Салемом и его коллегами из университетов Луизианы и Юты.

Рис. 4.3. Типирование ДНК и эволюция гоминидов. Наличие определенных повторов SINE в ДНК разных видов организмов определяют по яркой полосе на соответствующей дорожке в геле. Наличие одинаковых повторов у представителей разных видов указывает на их эволюционное родство. Из статьи Salem et al., 2003, Proceedings of the National Academy of Science 100:12 787. © 2003 by the National Academy of Sciences, USA.


Наличие или отсутствие SINE определяется по положению полос ДНК в геле, используемом для разделения фрагментов ДНК разного размера. Один из повторов, представленных на рисунке, специфичен только для человека, второй является общим для человека, карликовых шимпанзе (бонобо) и шимпанзе, а третий — для человека, бонобо, шимпанзе, горилл, орангутанов и сиамангов (сростнопалых гиббонов). Среди 100 с лишним повторов были выявлены такие, которые являются общими для разных групп приматов, в том числе для всех шести исследованных видов человекообразных обезьян, а также лишь для пяти, четырех и т. д. видов человекообразных. Также были выявлены повторы, которые являются общими лишь для бонобо и шимпанзе, и уникальные для человека, бонобо или шимпанзе. Ни один из исследованных повторов не был обнаружен в геноме ночных (совиных) обезьян. Количество повторов, являющихся общими для разных видов, отражает степень родства этих видов, и может служить для построения генеалогического древа (рис. 4.4).

Рис. 4.4. Эволюционное древо гоминоидов. Эволюционное родство между гоминидами и обезьянами, установленное на основании анализа ДНК. На основании данных из Salem et al., 2003, Proceedings of the National Academy of Science 100:12 787.


Из этого древа следует, что ближайшими родственниками человека являются шимпанзе, ближайшими родственниками шимпанзе — бонобо, а ветви горилл и орангутанов отделились от древа до появления последнего общего предка человека и шимпанзе. Достоверность этой информации не подлежит сомнению.

Теперь давайте с помощью этого древа займемся изучением происхождения цветового зрения и опсинов.

Запутанная история возникновения цветового зрения

Все человекообразные и другие обезьяны Старого Света (африканские и азиатские) обладают трихроматическим цветовым зрением и имеют три гена опсинов, тогда как американские обезьяны, а также грызуны и другие млекопитающие обычно обладают дихроматическим зрением и имеют два гена опсинов. Глядя на рис. 4.4, можно сделать вывод, что полноценное цветовое зрение возникло у предка приматов Старого Света после разделения линий, обитающих в Старом и Новом Свете. Кроме того, поскольку приматы Старого Света имеют третий зрительный пигмент колбочек, соответствующий ген опсина также должен был появиться после этого разделения. Это говорит о том, что наша с вами способность воспринимать цвета появилась у нашего древнего предка в Старом Свете, а не возникла независимо в ходе более поздней эволюции гоминидов.

Наличие у других млекопитающих (белок, кошек, собак и др.) лишь двух опсинов и дихроматического зрения означает, что общий предшественник всех млекопитающих обладал дихроматическим зрением. Но, прежде чем мы сделаем вывод о том, что полноценное цветовое зрение приматов является их «уникальным усовершенствованием», нужно исследовать зрение других позвоночных. Тут-то и возникает загвоздка. Прекрасным цветовым зрением обладают птицы, а также рептилии и многие рыбы, в частности золотые рыбки. У этих животных обнаружено не менее четырех генов опсинов. А у некоторых более примитивных позвоночных, таких как миноги, найдено пять генов опсинов. Это означает, что цветовое зрение возникло на очень ранних этапах эволюции позвоночных животных — до их разделения на челюстных и бесчелюстных. Поэтому, если рассматривать эволюционное древо позвоночных животных в целом, выясняется, что не относящиеся к приматам млекопитающие в какой-то момент потеряли гены опсинов и свою способность цветового зрения. Из картины распределения этих признаков у позвоночных можно сделать вывод, что в ходе эволюции способность к цветовому зрению сначала была широко распространена, но потом у предков млекопитающих она исчезла и возродилась вновь у предков приматов Старого Света.

Возможно, вы удивитесь: если цветовое зрение играет такую важную роль, как же оно могло исчезнуть? Наиболее правдоподобное объяснение связано с ночным образом жизни млекопитающих. Первые млекопитающие были мелкими животными и вели скрытный, ночной образ жизни в экосистемах, хозяевами которых были более крупные животные, такие как динозавры. При ночном образе жизни не нужно различать цвета, а нужно иметь возможность видеть в полумраке и в темноте. В следующей главе мы рассмотрим несколько примеров того, как подобные изменения образа жизни приводят к потере генов, включая гены цветового зрения.

Мы достаточно точно можем указать, когда в ходе эволюции приматов появился наш третий ген опсина. Остается ответить на вопрос о том, как это произошло. Как этот новый ген смог расширить диапазон цветового зрения? Этапы эволюции цветового зрения можно проследить по последовательности гена этого опсина. Итак, рассмотрим последовательности опсинов, проанализируем отличия двух наших красно-зеленых опсинов друг от друга и попробуем понять, какие из этих различий обеспечили их чувствительность к разным цветам. Общей закономерностью эволюции цветового зрения является «настройка» опсинов при адаптации к специфическим условиям. Сначала я расскажу вам, как настроены опсины человека, и представлю доказательства того, что они действительно полезны (адаптивны) для приматов. Затем я приведу несколько примеров того, как опсины разных видов организмов настроились на восприятие света с другой длиной волны при адаптации этих организмов к различным средам обитания и в ответ на различные стимулы.

Красное и зеленое

Крысы, мыши, белки, кролики, козы и другие млекопитающие имеют единственный MWS/LWS-опсин с максимумом поглощения при длине волны 510–550 нм. Этот опсин кодируется единственным геном. Напротив, человек обладает двумя опсинами (MWS и LWS), которые кодируются двумя генами на X-хромосоме, расположенными в тандеме «голова к хвосту». Последовательности ДНК этих двух опсинов совпадают на 98 %. Столь большое сходство и ближайшее соседство этих генов говорит о том, что они возникли в результате удвоения единственного гена опсина MWS/LWS у какого-то примата-предка. Удвоение генов — довольно распространенная форма изменения последовательности ДНК; многие наши гены в ходе эволюции приобрели по несколько копий. Рост числа копий гена увеличивает количество информации, на которую может влиять естественный отбор, и достаточно часто функции этих копий со временем начинают различаться. Именно это произошло с двумя олеинами на X-хромосоме.

Наша пара опсинов, как и опсины других приматов с три-хроматическим зрением, в наибольшей степени стимулируется светом с длиной волны 530 нм (зеленый) и 560 нм (красный) — это их максимумы поглощения. Изучение функциональных свойств опсинов показало, что их спектр поглощения достаточно легко изменить путем замены определенных аминокислотных остатков. То, что у всех приматов с трихроматическим зрением максимумы поглощения белков сохранились на длине волны 530 и 560 нм, означает, что это свойство белков поддерживается естественным отбором.

Последовательности зеленого и красного пигментов различаются всего 15 аминокислотными остатками. Заменяя одну аминокислоту на другую и анализируя результат, ученые смогли установить, какие именно аминокислотные остатки отвечают за особые свойства каждого из пигментов.

По-видимому, основной вклад в различие в максимумах поглощения красного и зеленого пигментов вносят аминокислоты в положениях 180, 277 и 285. Аминокислоты, находящиеся в этих позициях в двух пигментах, а также их вклад в сдвиг максимума поглощения, представлены в табл. 4.1.


Таблица 4.1. Аминокислоты в ключевых позициях человеческих опсинов

Исследования показывают, что после удвоения гена пигмента MWS/LWS у нашего далекого предка две образовавшиеся копии стали функционировать по-разному (одна настроилась на восприятие света с диной волны 530 нм, другая — 560 нм) главным образом в результате изменения аминокислотных остатков в этих трех ключевых позициях (рис. 4.5).

Рис. 4.5. Удвоение и тонкая настройка гена опсина у человекообразных обезьян. У общего предшественника обезьян и человекообразных обезьян Старого Света произошло удвоение гена опсина. Со временем в двух копиях возникли мутации, которые привели к настройке двух опсинов на поглощение красного или зеленого цвета. Сохранению этих мутаций способствовал естественный отбор. Рисунок Лианн Олдс.


Удвоение гена красно-зеленого зрительного пигмента произошло после разделения приматов Старого и Нового Света. По-видимому, это случилось 30 млн или 40 млн лет назад, вскоре после разделения африканского и южноамериканского континентов. По-видимому, последовавшие за удвоением гена эволюционные изменения аминокислот в трех ключевых позициях предоставляли существенные преимущества. Теперь в Азии и Африке живут обезьяны только с трихроматическим зрением. Если в период возникновения цветового зрения рядом с этими обезьянами обитали и другие, не обладавшие такой способностью (что кажется вполне вероятным), то они и их потомки уже вымерли.

Конечно, мы не были свидетелями этих событий, произошедших 30 млн или 40 млн лет назад, и кто-то может возразить, что все сказанное выше — всего лишь гипотезы. Однако важная роль цветового зрения у приматов — неоспоримый факт. В частности, у диких обезьян очень редко встречается дальтонизм. У людей цветовая слепота — достаточно распространенное явление: около 8 % мужчин белой расы не различают некоторых цветов из-за аномалии генов красно-зеленых опсинов на X-хромосоме, однако в дикой природе это большая редкость. При исследовании 3153 макак дальтонизм был обнаружен лишь у трех особей (менее 0,1 %). Высокий уровень распространения дальтонизма у людей (у которых цветовое зрение, по крайней мере в настоящее время, находится под очень слабым влиянием естественного отбора) и низкий — у диких макак говорит о том, что естественный отбор поддерживает способность цветового восприятия у этих обезьян и у других видов, обладающих трихроматическим зрением.

Второе свидетельство в пользу большой экологической значимости трихроматического зрения у приматов дали наблюдения за тем, как выбирают пищу ди- и трихроматические приматы в природных условиях. Питер Лукас из Университета Гонконга, Натаниэль Домини (теперь работает в Университете Калифорнии в Санта-Крузе) и их коллеги предприняли подробное исследование пищевых привычек и предпочтений колобусов и шимпанзе в Уганде, лемуров на Мадагаскаре и паукообразных обезьян в Коста-Рике. Ученые обнаружили, что животные, обладающие трихроматическим зрением, отдают явное предпочтение более нежным красноватым листьям, которые содержат больше белка. Большинство исследованных приматов питались еще и фруктами, и цвет фруктов также имел для них значение. Однако Лукас и Домини считают, что полноценное цветовое зрение играет более важную роль в выборе листьев, особенно когда фруктов мало или они еще не поспели.

Таким образом, способность воспринимать красный и зеленый цвет, по-видимому, дает определенные преимущества. Однако красный и зеленый — это только часть видимого спектра, наиболее важная для обитателей лесов. Но животные населяют самые разные уголки планеты, в том числе моря, где способность различать красный и зеленый цвета абсолютно бесполезна.

В глубоком синем море

На большие морские глубины солнечный свет проникает сквозь толщу воды, поэтому там темно. За зрение в слабом рассеянном свете отвечают фоторецепторы палочек, а опсин этих клеток называется родопсином. Родопсин человека и большинства наземных млекопитающих настроен таким образом, чтобы максимально поглощать свет с длиной волны около 500 нм.

На глубину около 200 м проникает лишь свет из узкого синего диапазона с длиной волны около 480 нм. Интересно, что родопсины глубоководных рыб и дельфинов сдвинуты в синюю область, то есть их максимум поглощения на 10–20 нм ниже максимума поглощения наземных млекопитающих. Ученые активно изучали тонкую настройку родопсина таких океанских жителей, как афалина, обыкновенный дельфин, черный дельфин, атлантический ремнезуб, солнечник и различные угри. Чтобы установить влияние отдельных аминокислотных остатков на различия между родопсинами разных видов животных, одни аминокислоты или их группы заменяли другими, обнаруженными у других видов. В частности, у афалины за сдвиг максимума поглощения родопсина на 10 нм в синюю область по сравнению с родопсинами наземных млекопитающих отвечают аминокислоты в положениях 83, 292 и 299 (рис. 4.6). Максимум поглощения родопсина ремнезуба еще сильнее сдвинут в синюю область (до 484 нм), и этот родопсин отличается от родопсина дельфина только аминокислотой в положении 299.

Рис. 4.6. Настройка родопсина зависит от глубины, на которой обитают морские животные. Глубоководные рыбы и китообразные имеют родопсин, максимум поглощения которого сдвинут в синюю область спектра по сравнению с родопсинами животных, обитающих на суше или на мелководье. У животных, обитающих на одинаковой глубине, часто в ключевых позициях в последовательности родопсина стоят одни и те же аминокислоты. Рисунок Джейми Кэрролл.


Связь «синего сдвига» родопсина с адаптацией к жизни в морских глубинах подкрепляется данными анализа родопсинов глубоководных и пресноводных угрей. Родопсин угря, обитающего на большой глубине, характеризуется сдвигом максимума поглощения в синюю область и в ключевых положениях имеет точно те же аминокислотные остатки, что и родопсин ремнезуба. Родопсин пресноводного угря имеет максимум поглощения, близкий к таковому у наземных млекопитающих, а в ключевых позициях в его последовательности находятся те же аминокислотные остатки, что и у ламантина и тюленя — двух обитающих на мелководье млекопитающих с типичным вариантом родопсина.

Эта поразительная связь между «синим сдвигом» родопсина и жизнью на большой глубине полна глубокого смысла. Резонно предположить, что естественный отбор способствовал настройке родопсина в соответствии со средой обитания. Однако существует еще более важная причина подозревать влияние естественного отбора, и она становится ясна при рассмотрении эволюционных связей между видами животных, перечисленных на рис. 4.6. Дельфины и ремнезубы относятся к отряду китообразных — млекопитающих, которые произошли от сухопутного предка, вернувшегося в водную стихию. Это может показаться удивительным, но ближайшими современными родственниками китообразных являются гиппопотамы, олени, коровы, свиньи и верблюды. Это следует из результатов анализа последовательностей SINE и LINE, а также других последовательностей ДНК. Поскольку родопсины наземных родственников китообразных настроены на длину волны 500 нм, можно с полным основанием заключить, что родопсин дельфинов и китов изменился после того, как их эволюционная ветвь отделилась от ветви других млекопитающих.

Однако угри — это рыбы, и их эволюционная ветвь отделилась от ветвей других позвоночных несколько сотен миллионов лет назад. Это означает, что одинаковые по своей сути различия между глубоководными и пресноводными угрями и морскими и наземными млекопитающими возникли независимо. Если в одинаковых позициях в каком-то белке у двух или нескольких видов животных при адаптации к определенным условиям появляются одни и те же аминокислотные остатки (как у китообразных и глубоководного угря в нашем примере), это говорит о работе естественного отбора. Замечу, что пример эволюции родопсина — лишь один из множества случаев, когда эволюция воспроизводит саму себя (мы подробнее поговорим об этом в шестой главе).

Теперь перейдем от красного, зеленого и синего к невидимым для нас цветам — и к целому миру взаимоотношений между животными, связанных с ультрафиолетовым зрением.

За пределами радуги

Примерно через 12 лет после выхода в свет книги «О происхождении видов» Дарвин опубликовал «Происхождение человека и половой отбор». Это был первый труд Дарвина, посвященный эволюции человека, но, возможно, еще важнее то, что Дарвин впервые обратил внимание на различную роль полов в эволюции признаков; он называл этот процесс «половым отбором». И сам половой отбор, и развитая Дарвином теория полового отбора известны широкой публике гораздо хуже, чем его теория естественного отбора, однако биологи считают половой отбор одним из наиболее важных и интересных механизмов в эволюции животных. Половой отбор — это арена, на которой «наилучшая приспособленность» оказывается напрямую связана с успешностью спаривания.

Дарвин был увлечен разнообразием птичьей окраски — он посвятил много времени изучению этого удивительного явления и оставил многостраничные описания роскошного оперения самых разных видов птиц. Особенно его интересовало, каким образом предпочтения самок могут привести к эволюции причудливого оперения самцов, такого как павлиний хвост. Еще со времен Дарвина птицы остаются излюбленным объектом биологов, изучающих половой отбор. Но до недавних пор подобные исследования имели один и тот же изъян: окраску птиц оценивали люди. Я уже говорил о том, что мы видим мир совсем не таким, каким его видят другие млекопитающие, и не таким, каким его или друг друга видят птицы. Многие птицы способны видеть в ультрафиолетовом свете и различать цвета, не существующие для нас, и эта способность играет важную роль в спаривании, поиске пищи и даже вскармливании птенцов.

У многих птиц опсины настроены на восприятие ультрафиолетового света, и на их оперении есть отметины, отражающие свет в ультрафиолетовой части спектра (рис. D-K).

Длина волны ультрафиолетового света меньше 400 нм, то есть меньше длины волны фиолетового света, и этот свет регистрируется коротковолновым опсином. Человеческий опсин SWS настроен на длину волны 417 нм. У некоторых видов птиц опсины SWS настроены на длину волны около 370 нм, поэтому эти птицы видят в ультрафиолетовом свете. Другие птицы имеют коротковолновые опсины, настроенные на фиолетовую область спектра, с максимумом поглощения около 405 нм, и эти птицы, как и люди, не могут воспринимать ультрафиолетовый свет. Лабораторные исследования помогли установить, какие изменения опсинов SWS отвечают за чувствительность птиц к ультрафиолету.

Одна специфическая позиция, а именно позиция 90 в коротковолновом опсине, напрямую связана со способностью птиц воспринимать фиолетовый или ультрафиолетовый свет. Те птицы, у которых в этом положении находится аминокислота серин, видят в фиолетовой области спектра, а те, у которых в этом месте располагается цистеин, видят в ультрафиолетовом диапазоне (рис. 4.7).

Рис. 4.7. Эволюция способности птиц к восприятию ультрафиолетового света. Восприятие птицами фиолетового или ультрафиолетового света в значительной степени зависит от того, какая аминокислота — серин (S) или цистеин (C) — находится в позиции 90 в молекуле коротковолнового опсина. Замена аминокислоты в этой позиции в разных отрядах птиц происходила не менее четырех раз. Рисунок Джейми Кэрролл.


Седзо Йокояма, один из ведущих специалистов в области цветового зрения, и его коллеги из Университета Эмори (Джорджия) напрямую показали, что замена серина на цистеин делает пигмент, чувствительный к фиолетовому свету, чувствительным к ультрафиолетовому свету, а замена цистеина на серин в пигменте, чувствительном к ультрафиолету, делает его восприимчивым к фиолетовому свету. Разница в одной-единственной аминокислоте обеспечивает сдвиг максимума поглощения на 35–38 нм, что чрезвычайно много. Эти исследования показывают, что одна замена способна изменить функцию опсина, и следовательно, эволюция опсина, чувствительного к фиолетовому или ультрафиолетовому свету, может быть относительно простым, одностадийным процессом.

Птицы, обладающие способностью видеть в ультрафиолетовом свете, относятся к девяти семействам из четырех разных отрядов. На основании их родственных связей можно сделать вывод, что у птиц способность видеть в ультрафиолетовом свете возникала в ходе эволюции независимым образом не менее четырех раз. Во всех отрядах, к которым относятся птицы, способные воспринимать ультрафиолет, есть также птицы с фиолетовым типом SWS-опсина. Это означает, что мутация, заменившая серин на цистеин в молекуле фиолетового пигмента, происходила в ходе эволюции несколько раз.

В ситуации с ультрафиолетовым зрением эволюция вновь повторяет саму себя. Это убедительное доказательство того, что на гены опсина оказал воздействие отбор. Однако в данном случае это мог быть половой отбор, поскольку многочисленные исследования показывают, что на выбор партнера у птиц, способных видеть в ультрафиолетовой области спектра, влияет окраска, различимая только в ультрафиолетовом диапазоне (рисунки D-K цветной вкладки).

Например, самки скворцов выбирают себе партнера по окраске оперения, видимой только в ультрафиолетовом свете, а не в видимой области спектра, которую воспринимает человек. Это открытие было сделано в ходе эксперимента, когда птиц помещали в специальные камеры, позволяющие фильтровать свет с определенной длиной волны. При наличии ультрафиолетового света самки по-другому оценивали самцов, причем явно отдавали предпочтение тем, у которых кончики перьев на груди несут ультрафиолетовые отметины.

Аналогичным образом самцы лазоревки (синей синицы) отличаются от самок тем, что голубая шапочка у них на голове отражает свет в ультрафиолетовом диапазоне (рисунки D-G цветной вкладки). В лабораторных экспериментах самки отдают предпочтение тем самцам, шапочка которых наиболее сильно отражает ультрафиолет. Именно поэтому ученые из Бристольского университета, проводившие это исследование, назвали свою статью «Синие синицы на самом деле ультрафиолетовые».

Способность видеть в ультрафиолетовом свете помогает не только в выборе партнера. Недавно было доказано, что у восьми видов птиц рты птенцов, особенно края клювов, отражают свет в ультрафиолетовом диапазоне. Это означает, что вернувшиеся к гнезду родители даже в темноте могут видеть рты своих детенышей. Кроме того, сильные птенцы, по-видимому, сильнее отражают ультрафиолетовый свет, так что в конкуренции между птенцами наиболее приспособленными оказываются те, чьи клювы заметнее для кормящих родителей.

Есть данные и о том, как способность воспринимать ультрафиолетовый свет используется для охоты. Лазоревки используют свое ультрафиолетовое зрение для поиска гусениц, имеющих маскирующую окраску в видимой области спектра. Хищная птица пустельга охотится на мышей-полевок, отслеживая участки наибольшего скопления мышей по их экскрементам, которые отражают ультрафиолетовые лучи.

Способностью видеть в ультрафиолетовом свете обладают, конечно же, не только птицы. Известны некоторые виды рыб, амфибий, рептилий и млекопитающих (таких как летучие мыши), которые видят в ультрафиолетовом свете, и у каждого из этих видов животных есть опсин SWS, настроенный на длину волны 360–370 нм. Широкое распространение этой способности говорит о том, что она подходит для самых разных целей. Это один из общих принципов эволюции: одно новшество создает возможности для эволюции дополнительных новшеств. В завершении данной главы я вновь вернусь к обезьянам колобусам и расскажу о том дополнительном наборе новшеств, которые появились у этих животных вдобавок к умению находить самые питательные листья. Это еще один яркий пример развития новых способностей на основе «старых» генов.

Жвачные обезьяны

В отличие от большинства приматов, которые употребляют в пищу в основном фрукты и насекомых, обезьяны колобусы питаются листьями. Переваривать листья колобусу, как и другим жвачным животным, помогают бактерии, населяющие передний отдел кишечника — один из отделов многокамерной пищеварительной системы. Подобно коровам и другим жвачным животным колобус извлекает питательные вещества, расщепляя бактерии с помощью различных ферментов. Один из важных ферментов, рибонуклеаза, образуется в поджелудочной железе и секретируется в тонкую кишку, где расщепляет РНК. Этот фермент помогает высвободить большое количество азота, заключенного в РНК ферментирующих бактерий. В поджелудочной железе колобуса и обычных жвачных животных содержится больше рибонуклеазы, чем у других млекопитающих, поэтому ученые заинтересовались эволюцией этого пищеварительного фермента.

Выяснилось, что большинство млекопитающих, в том числе обезьяны, имеют лишь одну копию гена панкреатической рибонуклеазы, тогда как у колобуса таких генов три. В ходе эволюции этих обезьян ген рибонуклеазы удвоился. Жианши Цанг из Университета Мичигана подробно изучил рибонуклеазы и кодирующие их гены и пришел к выводу, что одна копия гена кодирует фермент, фактически идентичный ферменту других видов обезьян, но две другие, «новые» копии изменились и подстроились под нужды пищеварительной системы колобуса.

Всего в последовательностях двух новых копий рибонуклеазы обнаружено соответственно десять и тринадцать аминокислотных замен по сравнению с традиционной версией фермента. Одно из наиболее важных отличительных свойств новых белков состоит в том, что они обладают повышенной активностью в более кислой среде. Эта особенность согласуется с различиями в устройстве системы пищеварения колобусов и других приматов.

Но это открытие — не единственное доказательство участия естественного отбора в эволюции рибонуклеазы. Еще более весомые доказательства получены в результате анализа последовательности генов и белков новых рибонуклеаз. Вспомните, в предыдущей главе мы говорили о том, что большинство изменений в ДНК являются синонимичными. Однако в двух новых версиях гена рибонуклеазы соотношение несинонимичных и синонимичных изменений очень высокое (примерно 4:1, тогда как для других белков это соотношение составляет 1:5). Это является прекрасным доказательством того, что специфические изменения белка были поддержаны естественным отбором.

Изобретаем и адаптируемся

Эволюция цветового зрения и пищеварительных ферментов — лишь два из огромного числа примеров увеличения объема генетической информации и ее настройки в ходе приспособления видов к новым экологическим нишам. Удвоение генов и их тонкая настройка под действием естественного отбора происходят повсеместно. Большинство наших генов относятся к семействам генов, расширившимся в ходе эволюции. Случайное удвоение генов или групп генов происходит достаточно часто. Многие люди различаются между собой по количеству копий генов.

Поскольку в момент своего появления новые копии генов являются избыточными, ненужными, со временем лишь часть их сохраняется и подвергается функциональным изменениям, о которых я рассказывал на примере опсинов и рибонуклеазы. Сохранение и настройка генов — это видоспецифический процесс, который зависит от вероятности, отбора и времени. Разная судьба генов приводит к разнице в количестве генов у разных видов, а также, что еще более важно, к физиологическим и другим различиям между видами. Мы увидели, что смена образа жизни, например освоение океанских глубин или переход на лиственную диету, сопровождается характерными изменениями генов, задействованных в этих процессах.

Однако приобретение и тонкая настройка генов — лишь одна сторона эволюционной адаптации. У этого процесса есть вторая сторона, которая также отражена в ДНК. Когда образ жизни вида изменяется по сравнению с образом жизни его предков, какие-то функции генов становятся ненужными, и такие гены начинают разрушаться. Если мы застаем ген в таком состоянии, он может многое рассказать об эволюционном изменении вида. Об этом мы и поговорим в следующей главе.

Латимерия. Фотография сделана с помощью глубоководного аппарата IAGO, сконструированного Юргеном Шоером и Хансом Фрике.

Глава 5 Ископаемые гены. Осколки прошлой жизни

Природа, вообще говоря, это единственная книга, которая сообщает нечто важное на каждой странице.

Иоганн Вольфганг Гете

Это был великолепный рождественский подарок.

В первой половине дня 22 декабря 1938 г. Марджори Куртене-Латимер получила от руководства местной флотилии сообщение о том, что «Нерин» пришвартовался и, возможно, она сможет найти новых рыб для своей коллекции. Мисс Латимер была первым куратором Ист-Лондонского музея естественной истории в Капской провинции Южной Африки. В этот день она была занята тем, что пыталась собрать выкопанный ею скелет динозавра, а также готовилась к предстоящим праздникам.

Однако из порта звонили нечасто, так что она решила отложить работу и заглянуть на корабль. Подобрав подол, она поднялась на борт траулера и стала осматривать лежащих на солнце вонючих акул, губок и других знакомых существ. Мисс Латимер уже собралась было вернуться в музей, когда вдруг увидела это. Под тушами других рыб она обнаружила «самую прекрасную рыбу, какую видела в жизни. Она была пяти футов в длину и имела бледную синевато-лиловую окраску с радужными отметинами».

Кроме того, это существо не было похоже ни на одну рыбу, виденную ею прежде. Оно было покрыто твердой чешуей, имело четыре похожих на лапы плавника и странный хвост, как у щенка. Мисс Латимер поняла, что этот экземпляр необходимо сохранить. Рыбина весила 127 фунтов[12], так что перевезти разлагающуюся тушу в музей было непростой задачей. Водителя такси пришлось долго уговаривать, чтобы он позволил погрузить ее в багажник.

Вернувшись в музей, мисс Латимер показала свою находку директору. Он быстро идентифицировал рыбу как каменного окуня. Мисс Латимер, которая была самоучкой в области естественной истории, думала иначе, однако ни один из справочников не помог ей определить рыбу, чья туша разлагалась на ее лабораторном столе. Мисс Латимер решила искать помощи на стороне — в лице профессора химии и ихтиолога-любителя Дж. Л. Б. Смита, работавшего в Университете Родоса, в 150 км от Ист-Лондона. Она не смогла до него дозвониться и поэтому на следующий день отправила ему по почте письмо с описанием и рисунком рыбы.

Смит получил письмо только после Нового года. В это время он поправлялся после болезни и, когда смог наконец прочесть письмо, поначалу пришел в недоумение. «И вдруг словно бомба взорвалась в моей голове: из наброска и письма проступили образы рыбоподобных существ, проплывавшие один за другим, словно на экране, — это были древние рыбы, которые жили в незапамятные времена и от которых остались лишь разрозненные отпечатки на камне».

Смит немедленно отправил мисс Латимер телеграмму:

НЕОБХОДИМО СОХРАНИТЬ СКЕЛЕТ И ЖАБРЫ ОПИСАННОЙ РЫБЫ.

Мисс Латимер между тем уже попросила таксидермиста сохранить рыбу, насколько это возможно.

Смита мучила не дававшая ему покоя безумная мысль. Дело в том, что и рисунок, и полученные им позднее чешуи говорили о том, что эта рыба — целакант, представитель группы рыб с парными плавниками, которые, как считалось, являлись близкими родственниками первых четвероногих позвоночных и вымерли в конце мелового периода, 65 млн лет назад.

Наконец Смиту довелось увидеть рыбу собственными глазами, что лишило его всех сомнений — и дара речи. Он писал: «Я забыл обо всем на свете и только смотрел и смотрел, а потом, почти трепеща, подошел, потрогал и погладил [ее]».

Смит назвал рыбу латимерией (Latimeria chalumnae) — в честь мисс Латимер и в честь реки[13], вблизи которой рыба была поймана. Прошло 14 лет, прежде чем Смит или кто-либо еще снова увидел латимерию (когда это случилось, Смит разрыдался). После этого было поймано много латимерий, в частности у берегов Индонезии был обнаружен другой вид этих рыб.

Латимерия занимает в естественной истории особое место. Это единственный сохранившийся представитель древней группы, строение тела которого роднит его с далекими предками, жившими 360 млн лет назад. Поэтому латимерию называют живым ископаемым.

В этой главе мы с вами откроем для себя новый тип ископаемых, который сохранился в ныне живущих организмах и связывает нас с очень далекими предками и самыми ранними формами жизни. Речь пойдет об ископаемых генах.

Мы уже видели, что переход к новому образу жизни (от жизни на суши к жизни в воде, от восприятия видимого света к ультрафиолетовому зрению или от питания фруктами и насекомыми к лиственной диете) сопровождается образованием и тонкой настройкой новых генов. Теперь мы увидим, что подобные изменения, кроме того, оставляют в ДНК следы в виде генов с утраченной или нарушенной функцией. Ископаемые гены хранятся в ДНК примерно так же, как окаменелости среди осадочных пород, а содержащаяся в этих генах информация со временем эродирует и разрушается. Для информации, заключенной в ДНК, существует железное правило: используй, или потеряешь. Распад текста ископаемых генов служит доказательством бездействия естественного отбора и является строго специфичным по отношению к конкретным генам и видам. Давайте посмотрим, каким образом эти обломки древнего кода отражают историю адаптации видов, включая человека, к новым условиям существования. Начнем с рассказа о ДНК латимерии и о некоторых теперь хорошо известных ископаемых генах, а потом рассмотрим несколько примеров массового превращения генов в ископаемые.

Смена места жительства и ископаемые гены опсинов

На волне огромного интереса к латимерии к местам ее естественного обитания были направлены экспедиции. Спускаясь на глубину, ученые наблюдали этих рыб в подводных пещерах вблизи Коморских островов и у берегов Южной Африки. Днем рыбы прячутся в пещерах, а ночью медленно перемещаются вблизи дна в поисках пищи. На глубину 100 м и более, где обитают латимерии, проникает лишь очень слабый синий свет.

Необычный образ жизни латимерий и их уникальный статус привлекли внимание к строению их зрительной системы и генов опсинов. Оказалось, что латимерия имеет родопсин, настроенный на восприятие тусклого рассеянного света, но не имеет MWS/LWS-опсина, регистрирующего свет в красно-зеленой области, как у других рыб и у человека. Поскольку рыбы, млекопитающие и большинство других позвоночных животных имеют хотя бы одну версию такого опсина, ясно, что предки латимерии также имели этот ген, но на каком-то этапе эволюции он был утрачен. Потеря этого гена вызывает общий вопрос: как и почему столь важный для одних видов ген теряется у других? Проиллюстрировать картину утраты функций гена можно на примере другого гена опсина, который все еще присутствует в ДНК латимерии, но постепенно разрушается.

У латимерии есть один ген опсина SWS. Вспомним, что этот опсин, настроенный на коротковолновую область спектра, у человека и птиц используется для восприятия фиолетового света, а у некоторых животных — для восприятия ультрафиолетового света. Однако в последовательности ДНК коротковолнового опсина латимерии обнаружено множество замен, которые нарушают информационное содержание гена. Например, в позициях 200–202 этого гена у мышей и других животных расположен триплет CGA, а у латимерии в этом месте стоит триплет TGA. Замена C на T может показаться не очень существенной, но в данном случае это важно. Дело в том, что триплет TGA представляет собой так называемый стоп-кодон, который служит в качестве точки, прерывающей трансляцию последовательности гена опсина SWS. Это лишает латимерию возможности синтезировать работоспособный белок SWS-опсин. Кроме того, в последовательности гена есть и другие делеции и замены, которые серьезно нарушают текст. Подобная ситуация говорит о том, что данный ген потерял свою функцию, то есть стал ископаемым геном (биологи называют такие гены псевдогенами, но я буду по-прежнему называть их ископаемыми). Этот ген функционировал у предков латимерии, но сегодня уже не работает. Его все еще можно узнать по сохранившимся фрагментам, но, поскольку функция его утрачена, он продолжает накапливать мутации и делеции и когда-нибудь совсем исчезнет из последовательности ДНК латимерии, как исчез ген опсина MWS/LWS (а также один из глобиновых генов у предков ледяной рыбы, о которой мы говорили в первой главе).

Вы, вероятно, спросите: почему хорошему гену было позволено разрушиться? Являются ли ископаемые гены редкой особенностью таких таинственных существ, как латимерия и ледяная рыба? Прежде чем ответить на эти вопросы, я приведу еще один показательный пример.

Исследование генов коротковолновых опсинов у дельфинов и китов показало, что у них, как у латимерии, ген опсина SWS тоже стал ископаемым. Например, у афалины в начале гена опсина SWS не хватает нескольких оснований (рис. 5.1).

Рис. 5.1. Ископаемый ген опсина у дельфина. Показаны короткие фрагменты генов коротковолновых опсинов дельфина и коровы. Закрашенные клетки обозначают позиции, в которых были потеряны основания (звездочки), что привело к нарушению кода опсина у дельфина. Рисунок Джейми Кэрролл.


Это нарушает триплетную структуру последовательности, сдвигает рамку считывания и делает ген полностью нефункциональным. Анализ генов коротковолновых опсинов других китообразных выявил в них ряд других замен, которые также привели к нарушению функций этих генов. У всех дельфинов и китов есть ископаемый ген опсина SWS.

Таким образом, мы имеем два примера ископаемых генов опсина SWS — у латимерии и китообразных. Есть ли между этими животными что-нибудь общее, что могло бы объяснить потерю функции их коротковолновых опсинов?

Прежде всего нужно сказать, что отмирание генов опсинов у этих групп животных произошло независимо. Мы знаем это, поскольку знаем положение этих видов животных на эволюционном древе позвоночных (рис. 5.2).

Рис. 5.2. Один и тот же ген опсина дважды стал ископаемым. Распределение различных мутаций в генах опсинов SWS латимерии и китообразных, а также эволюционная связь этих видов животных говорят о том, что ген SWS-опсина становился ископаемым как минимум два раза (звездочки). Рисунок Джейми Кэрролл.


Латимерия относится к группе примитивных рыб, отделившейся от ветви, давшей начало четвероногим позвоночным. У амфибий, рептилий, птиц и многих млекопитающих гены коротковолновых опсинов не пострадали, следовательно, отмирание этого гена у латимерии произошло в ходе эволюции ее ветви. Поскольку гиппопотамы и коровы — близкие родственники китов и дельфинов — сохранили функциональные SWS-опсины, а китообразные нет, можно сделать вывод, что функция SWS-опсина китообразных была утеряна у общего предка всех дельфинов и китов. Отсутствие функционального коротковолнового опсина у современных дельфинов и китов связано с наследованием этого ископаемого гена от их общего предка, жившего более 40 млн лет назад.

Лучшим объяснением потери функции отдельных генов является изменение образа жизни животных. Безусловно, должна быть какая-то связь между неиспользованием опсина SWS и жизнью в море. Дельфины и киты живут только в воде и принадлежат к единственному отряду млекопитающих, полностью потерявших способность различать цвета (поскольку в колбочках их сетчатки есть только один тип опсина, тогда как у большинства других млекопитающих их два). Как мы уже говорили, родопсин дельфинов настроился на восприятие тусклого света в синей области видимого спектра. Латимерия тоже обитает на большой глубине и, по-видимому, не нуждается в цветовом зрении. Экологическое объяснение потери функции коротковолнового опсина состоит в том, что он перестал быть необходимым предкам этих животных.

Отсутствие потребности в белке привело к тем изменениям, которые мы видим в последовательности его гена. Если опсин больше не нужен, естественный отбор, который в норме должен поддерживать его существование, ослабевает. А если ослабевает давление со стороны естественного отбора, ДНК перестает очищаться от мутаций, разрушающих ее функцию. Случайность возникновения мутаций означает, что все гены подвергаются мутациям. В большинстве случаев вредные мутации исчезают благодаря очистительному действию естественного отбора, поскольку мутантные особи и их потомство являются менее приспособленными. Но если какой-то признак перестает быть предметом отбора (например, при перемене места жительства), необходимые раньше гены становятся ненужными, и в них накапливаются мутации.

Используй, или потеряешь.

Говоря научным языком, ископаемые гены — это то, во что должны были бы превратиться со временем любые гены в результате постоянного действия мутаций, если бы не было естественного отбора. Очевидным признаком того, что ген стал ненужным, является накопление мутаций, разрушающих содержащуюся в нем информацию. Таким образом, ископаемые гены отражают различия в образе жизни современного вида и его предков, и если такие гены удается обнаружить, они помогают реконструировать ход естественной истории.

Я приведу еще несколько примеров отмирания генов опсинов, связанных с другими переменами в образе жизни животных, а потом мы вовлечем в наше обсуждение еще больше ископаемых генов и еще больше видов.

Жизнь в темноте

Основная теория, объясняющая уменьшение числа генов опсинов и потерю полноценного цветового зрения у предков млекопитающих, заключается в том, что первые млекопитающие, напоминающие грызунов, были ночными животными, и поэтому способность различать цвета была им просто не нужна. У млекопитающих переход к ночному образу жизни происходил многократно, поэтому один из способов проверки этой теории и более общей идеи о том, что потеря функций генов связана со сменой образа жизни, состоит в изучении более современных видов с заметно различающимся образом жизни.

Примером может служить ночная (совиная) обезьяна — единственный представитель высших приматов, ведущий ночной образ жизни (рис. 5.3).

Рис. 5.3. Ночные или подземные млекопитающие с ископаемыми генами опсинов. У ночной обезьяны (вверху слева; фотография Грега и Мэри Бет Димиджан), галаго (внизу слева; фотография Б. Смита, Нигерия), толстого лори (вверху справа; фотография Ларри П. Такетта, www.tackettproductions.com) и слепыша (внизу справа; фотография Тали Кимчи) гены коротковолновых опсинов превратились в ископаемые гены в результате адаптации к ночному или подземному образу жизни.


Анализ генов коротковолновых опсинов этих животных показал, что в них также накопились мутации, из-за которых они перестали работать. На расстоянии 60 оснований от начала гена опсина триплет TGG мутировал в TGA — еще один случай появления стоп-кодона, прерывающего трансляцию оставшейся части гена. У всех дневных родственников ночных обезьян ген SWS-опсина полностью функционален, и это хороший довод в пользу того, что переход к ночному образу жизни привел к отмене давления со стороны естественного отбора.

Гипотезу о связи между ночным образом жизни и опсином SWS можно дополнительно проверить, исследуя гены опсинов ночных полуобезьян. Полуобезьяны — это группа примитивных приматов, к которым относятся лемуры, долгопяты, галаго и лори. Среди лемуров встречаются виды, ведущие как дневной, так и ночной образ жизни, однако толстый лори и галаго — исключительно ночные животные (см. рис. 5.3). Анализ их генов опсинов SWS показал, что эти гены стали ископаемыми. У обоих видов в начале гена коротковолнового опсина отсутствует большой фрагмент текста, что делает невозможным синтез соответствующего белка. Поскольку у обоих видов эта делеция имеет один и тот же размер и находится в одном и том же месте, это означает, что потеря функции опсина SWS произошла у общего предка галаго и лори и была унаследована его потомками.

До сих пор все логично. По-видимому, освещенность среды обитания коррелирует с утратой (или сохранением) генов, ответственных за цветовое зрение. Но давайте проведем еще одну проверку: как насчет животных, перешедших к подземному образу жизни?

Слепыши — это грызуны, у которых глаза атрофировались сильнее, чем у каких-либо других млекопитающих (см. рис. 5.3). Судя по окаменелостям, эта группа животных произошла от наземного предка, обладавшего нормальными глазами. Эволюция слепыша сопровождалась многочисленными изменениями анатомии и физиологии. Его глаза настолько малы, что не могут различать изображения. Кроме того, даже если бы глаза остались нормальными, видеть это животное все равно было бы не в состоянии, поскольку его глаза полностью скрыты под слоем кожи и меха. Однако слепыш может определять время суток: в его глазах сохранилась сетчатка, способная распознавать свет, что позволяет животному поддерживать суточный биоритм.

Исследования показали, что у слепыша нормально функционируют два гена опсина — смещенный в красную область спектра пигмент MWS/LWS, настроенный на восприятие света подкожным глазом, а также родопсин, воспринимающий тусклый рассеянный свет. Очевидно, несмотря на атрофированное зрение, естественный отбор продолжает поддерживать функцию этих генов, чтобы животное могло жить в обычном суточном ритме. Однако ген опсина SWS у слепышей стал ископаемым и содержит множество мутаций, нарушающих генетический текст.

Итак, я привел пять независимых примеров вырождения генов коротковолновых опсинов — у латимерии, китообразных, ночной обезьяны, толстого лори и галаго, а также у слепыша. В каждом случае нарушение функции гена коррелировало с изменением образа жизни животного. В каждом случае имел место особый характер повреждения гена опсина SWS. Этот факт, а также то, что эти виды животных принадлежат к различным ветвям эволюционного древа, а их близкие родственники имеют нормальные опсины, говорит о том, что исчезновение функции генов коротковолновых опсинов происходило многократно и независимо на разных этапах эволюции. Таким образом, предположение о том, что ослабление действия естественного отбора на ген ведет к разрушению этого гена, находит убедительное подтверждение. Более того, у всех перечисленных видов животных другие типы опсинов сохраняют свое строение и функцию, что означает, что процесс разрушения генов является крайне избирательным.

Частая утрата гена опсина SWS и связь этого явления с изменением образа жизни говорят о том, что эволюционные изменения часто сопровождаются нарушением функций генов. Теперь давайте обратимся к анализу генома человека, найдем в нем ископаемые гены и посмотрим, что они могут рассказать о наших отличиях от предков.

Не чувствуете, чем пахнет?

Мы увидели немало примеров того, как смена образа жизни приводит к приобретению или к потере генов, отвечающих за зрение. Другие системы восприятия, особенно обоняние, также имеют важнейшее значение для выживания и поведения животных. Достаточно один раз прогуляться в парке с собакой, чтобы понять, в какой степени «видение» мира этими животными определяется их острым нюхом.

Многие другие млекопитающие также обладают прекрасным обонянием, при помощи которого они находят себе пропитание, идентифицируют партнера и потомство, распознают опасность. На протяжении длительного времени механизм улавливания и различения запахов оставался для ученых загадкой. В 1991 году Линда Бак и Ричард Эксел обнаружили семейство генов, кодирующих рецепторы пахучих молекул. Гены обонятельных рецепторов образуют самое крупное семейство генов в геноме млекопитающих. Мышь имеет около 1400 таких генов, а весь ее геном состоит из 25 тыс. генов. Оказалось, что специфичность распознавания запахов связана с тем, что каждая обонятельная нервная клетка имеет лишь один тип (в редких случаях несколько) обонятельного рецептора, настроенного на восприятие конкретной группы пахучих молекул. Восприятие каждого запаха зависит от сочетания рецепторов, участвующих в его распознавании. За разгадку механизма обоняния Бак и Эксел в 2004 г. были удостоены Нобелевской премии в области физиологии и медицины.

Человеческие гены, ответственные за обоняние, изучены очень подробно. Как оказалось, в этой области восприятия человеку по сравнению с мышью похвастаться нечем. Около половины генов обонятельных рецепторов человека стали ископаемыми, не способными производить функциональные рецепторы. Самый разительный контраст между человеком и другими млекопитающими наблюдается в группе рецепторов, кодируемых так называемыми V1r-генами. У мыши обнаружено около 160 функциональных рецепторов V1r, тогда как в геноме человека из 200 генов V1r лишь пять сохранили свою функцию. Очевидно, что наш ассортимент обонятельных рецепторов заметно сократился.

Столь высокое содержание ископаемых генов обонятельных рецепторов говорит о том, что мы больше не полагаемся на обоняние в той же степени, что наши предки. И тут возникает два вопроса. Во-первых, почему мы перестали использовать такую значительную часть наших обонятельных рецепторов? И во-вторых, когда это произошло?

Чтобы найти ответ, стоит проанализировать долю ископаемых генов обонятельных рецепторов у других приматов и млекопитающих. Профессор Иов Гилад и его коллеги из Вейцмановского института в Реховоте и Института эволюционной антропологии Макса Планка в Лейпциге изучили наборы генов обонятельных рецепторов у человекообразных обезьян, обезьян Старого и Нового Света и лемуров и сравнили их с набором мышиных генов. Они обнаружили удивительную корреляцию между долей ископаемых генов обонятельных рецепторов и эволюцией полноценного цветового зрения. У мышей, лемуров и обезьян Нового Света, не имеющих полноценного цветового зрения, ископаемыми являются лишь 18 % генов обонятельных рецепторов. Однако у колобусов и других обезьян Старого Света эта цифра достигает 29 %, а у человекообразных обезьян (орангутана, шимпанзе и гориллы) — 33 %. Наконец, у человека ископаемыми стали 50 % генов обонятельных рецепторов. Таким образом, доля нефункциональных генов обонятельных рецепторов значительно выше у тех видов, которые наделены полноценным цветовым зрением. Это означает, что эволюция трихроматического зрения, которое позволяет этим приматам обнаруживать еду, партнеров и опасность, ослабила их зависимость от способности распознавать запахи. Ослабление отбора генов обонятельных рецепторов у видов, обладающих трихроматическим зрением, привело к разрушению этих генов. Напротив, животные, которые в основном полагаются на обоняние, гораздо лучше сохранили свой набор генов обонятельных рецепторов.

Существуют и другие физические, поведенческие и генетические признаки, свидетельствующие об ослаблении роли обоняния в жизни человека и других приматов. Вомероназальный (или сошниково-носовой) орган — орган восприятия, имеющий форму сигары и расположенный в передней части носовой камеры, — у большинства наземных позвоночных служит для обнаружения феромонов. Однако у человека и высших приматов он в значительной степени редуцирован. Упомянутые мною рецепторы класса V1r играют важнейшую роль в обнаружении феромонов. Таким образом, при выборе партнера мы меньше ориентируемся на феромоны, чем другие млекопитающие, возможно, по той же самой причине — поскольку наши предки для выбора партнера и других функций стали больше полагаться на зрительные сигналы.

Поскольку вомероназальный орган и рецепторы V1r у человека и других высших приматов настолько редуцированы, можно предположить, что дегенерации подверглись и другие механизмы, задействованные в передаче информации от обонятельных органов. И это действительно так. Еще один ген, играющий важную роль в работе вомероназального органа, TRPC2, кодирует белок, регулирующий транспорт ионов в сенсорных клетках. У мышей белок TRPC2 полностью функционален и участвует в реакциях на феромоны. Однако у человека и других высших приматов с трихроматическим зрением и большим количеством редуцированных обонятельных рецепторов ген TRPC2 содержит множество мутаций, нарушивших его функцию.

Тот факт, что гены с разными функциями в обонятельной системе стали ископаемыми генами, — поразительное, исчерпывающее подтверждение предположений о том, что должно происходить в результате ослабления действия отбора на какой-либо признак. Когда целый орган или процесс становится ненужным, гены, участвующие в реализации различных этапов этого процесса, перестают быть объектом отбора и постепенно превращаются в ископаемые. Эволюция вомероназального органа и его отдельных элементов показывает, что целые комплексы генов могут выходить из употребления, распадаться и исчезать. Этот процесс можно наблюдать у некоторых видов, причем иногда он становится массовым. Я приведу два примера из других царств в качестве иллюстрации того, как эволюция убирает то, что больше не используется.

Используй, или потеряешь

Дрожжи и другие грибы играют важную роль в жизни людей. Дрожжи мы используем для производства пива, вина и хлеба, а грибы стали для нас первым источником антибиотиков. Пекарские и пивные дрожжи Saccharomyces cerevisiae давно уже стали излюбленным лабораторным организмом, поскольку их очень легко выращивать. Эксперименты с дрожжами позволили узнать очень многое о росте и делении клеток, об использовании генов и о биохимических основах жизни.

Однако на свете существуют не только старые добрые пивные дрожжи, но и множество других видов дрожжей. Под микроскопом большинство из них очень похожи, однако их способности переваривать питательные вещества и расти в различных условиях зачастую заметно различаются. Распад питательных веществ на полезные компоненты осуществляется в результате последовательности реакций, называемых метаболическим путем. Одним из наиболее хорошо изученных метаболических путей является путь расщепления галактозы у пекарских дрожжей. Большинство организмов в качестве источника энергии используют глюкозу. Однако, когда глюкозы нет, они вынуждены расходовать запасные сахара (например, крахмал) или искать альтернативные источники энергии. В частности, пекарские дрожжи могут использовать другой сахар — галактозу, которую они умеют переводить в глюкозу путем серии ферментативных реакций. В этих реакциях (в этой цепи) задействованы четыре фермента, закодированные четырьмя разными генами. Для того чтобы дрожжи синтезировали эти ферменты только при необходимости и в присутствии галактозы, синтез этих четырех ферментов контролируют еще три белка. Таким образом, в метаболизме галактозы в пекарских дрожжах участвует семь генов.

Большинство ближайших родственников пекарских дрожжей также могут использовать галактозу, за исключением одного вида дрожжей. Этот вид, Saccharomyces kudriavzevii (попытайтесь быстро произнести это название несколько раз подряд[14]), был обнаружен в Японии, на гниющей листве, тогда как большинство других дрожжей обитают в богатых сахарами средах. Когда мой аспирант Крис Хиттингер занялся изучением генов метаболизма галактозы у S. kudriavzevii, он быстро понял, почему этот организм не может расщеплять галактозу: все гены были испорчены. Все семь генов имели различные повреждения, нарушавшие целостность заключенной в них информации.

У S. kudriavzevii наблюдается разительный контраст между состоянием семи генов, участвующих в расщеплении галактозы, и состоянием их ближайших соседей по ДНК. Соседние гены прекрасно сохранились и так же функциональны, как у пекарских дрожжей и других родственных видов. Если представить себе последовательность гена в виде абзаца текста, то текст каждого гена метаболизма галактозы у S. kudriavzevii во многих местах оказался стертым, тогда как предыдущие и последующие абзацы прекрасно пропечатаны. Это говорит о том, насколько специфичным является процесс отмирания генов. В генах, которые больше не нужны и не используются, накапливается множество мутаций, а нужные соседние гены остаются в целости и сохранности. Судьба семи генов S. kudriavzevii демонстрирует способность естественного отбора сохранять то, что нужно организму, и его бездействие в отношении того, что уже не нужно. Этот вид дрожжей адаптировался к использованию других источников сахара и утратил способность расщеплять галактозу. Без постоянного надзора со стороны естественного отбора гены метаболизма галактозы собрали множество мутаций, стали ископаемыми и постепенно исчезают.

Утрата семи функционально связанных генов кажется мне чрезвычайно выразительным примером того, как значительное число генов могут погибнуть без внимания со стороны естественного отбора, но бывают примеры и более яркие — например, то, что произошло с некоторыми другими микроорганизмами, в частности с патогенным микроорганизмом Mycobacterium leprae, вызывающим проказу.

Анализ генома M. leprae показал, что в нем содержится около 1600 функциональных генов и почти 1100 ископаемых генов — доля мертвых генов тут намного выше, чем в любом другом организме. Бактерия M. leprae является родственником бактерии M. tuberculosis, вызывающей туберкулез легких. Однако M. tuberculosis имеет около 4 тыс. функциональных генов и лишь шесть ископаемых. Сравнение двух видов показывает, что в ходе эволюции около 2 тыс. генов M. leprae оказались испорченными или утерянными. Чем объясняется такое поразительное различие в числе функциональных и ископаемых генов у двух родственных организмов?

Дело в том, что M. leprae ведет совершенно иной образ жизни, чем ее родственник. Эта бактерия может жить только внутри клеток организма-хозяина. Она поселяется в клетках, называемых макрофагами, и инфицирует клетки периферической нервной системы, разрушение которых приводит к типичным для проказы физическим увечьям. Эта бактерия растет медленнее, чем любые другие известные бактерии (ее клетки делятся примерно раз в две недели, тогда как клетки E. coli у нас в кишечнике делятся каждые 20 минут). Несмотря на многолетние попытки ученых, в лабораторных условиях эту бактерию так и не удалось вырастить в самостоятельном виде. Жизнь внутри чужих клеток позволяет M. leprae пользоваться многими метаболическими процессами хозяина. Поскольку большую часть работы выполняют гены хозяина, многие гены M. leprae оказались без присмотра со стороны естественного отбора. Такое же массовое разрушение генов, как в клетках M. leprae, произошло и в других внутриклеточных паразитах и патогенах. Пример организмов со значительно уменьшившимся числом функциональных генов показывает, что при изменении образа жизни значительная доля всех генов может стать ненужной.

Исчезновение отдельных генов, групп функционально связанных генов или даже более широкого набора генов у определенного вида имеет важные последствия для будущей эволюции его потомков. Поскольку в разрушающихся генах накапливается множество дефектов, их инактивация обычно является необратимым процессом. Потеря функции гена — это улица с односторонним движением. Функция потеряна, и ее уже не вернуть. Как новые виды ледяных рыб не смогут больше иметь и использовать гемоглобин, так и потомки S. kudriavzevii не смогут питаться галактозой. Потеря генов и нарушение их функций накладывают ограничения на развитие эволюционной ветви.

Используй, или потеряешь — нерушимое правило, обусловленное тем, что естественный отбор действует только в настоящем времени, он не умеет строить планы на будущее. Оборотная сторона этого правила заключается в том, что при смене условий, пусть даже в отдаленном будущем, те виды, которые утратили какие-то гены, не смогут воспользоваться ими для адаптации к новым условиям. Возможно, это один из важных факторов, объясняющих расцвет или исчезновение видов. Не стоит забывать, что, по мнению биологов, более 99 % некогда существовавших видов организмов на настоящий момент вымерли.

Причина или следствие?

Широкое распространение ископаемых генов открывает большие возможности для изучения эволюции. Но, кроме того, оно поднимает вопрос о причинно-следственной связи. Является ли отмирание генов причиной эволюционных изменений, вызванных естественным отбором, или это следствие — побочный эффект естественного отбора каких-то других признаков? По-видимому, возможно и то и другое — в зависимости от конкретных условий. Я поясню это на примере недавно образовавшихся ископаемых генов у цветковых растений и у человека; в первом случае образование ископаемых генов является, скорее всего, причиной, а во втором — следствием.

У растений окраска цветов часто играет важную роль в привлечении опылителей, особенно пчел и птиц. Известно множество хорошо изученных примеров эволюционных изменений у животных-опылителей. Легко себе представить, что изменение климата или количества опылителей может повлиять на отбор окраски цветов. Более того, поскольку цветы, снабжающие нектаром пчел и колибри, могут посещать и другие — непрошеные — гости, отбору подвергаются и другие признаки цветка, что позволяет настроить его на различных опылителей. Например, растения, опыляемые птицами, обычно производят больше нектара и имеют цветы вытянутой формы, тогда как растения, опыляемые пчелами, производят меньше нектара и имеют более широкие и плоские цветки.

Раньше у ипомеи, относящейся к семейству вьюнковых, цветы были синими или лиловыми. Эту группу растений обычно опыляют пчелы, однако один вид, Ipomoea quamoclit, имеет красные цветы и опыляется колибри. По-видимому, красный цвет цветка является адаптацией, способствующей привлечению птиц.

Красный, синий или лиловый цвет цветков ипомеи определяется составом ферментов. Из одного и того же исходного вещества разные наборы ферментов производят либо синий и лиловый, либо красный пигмент. Недавно Ребекка Зуфолл и Марк Раушер из Университета Дьюка (Северная Каролина) показали, что у I. quamoclit, обладающей красными цветками, произошло разрушение метаболического пути синтеза синего и лилового пигментов. Один из генов этого пути полностью испорчен, а второй изменился до такой степени, что может участвовать только в синтезе красного пигмента.

Поскольку появление красной окраски цветков ипомеи является адаптацией, причем, по-видимому, напрямую связанной с модификацией двух конкретных ферментов, инактивация генов в этом примере, скорее всего, стала причиной эволюционных изменений. Кажется более вероятным, что естественный отбор напрямую способствовал инактивации ферментов для синтеза синего и лилового пигментов и эволюции красной окраски, чем то, что инактивация ферментов стала побочным результатом отбора какого-то другого признака.

Однако чаще инактивация и разрушение генов являются следствием ослабления давления со стороны естественного отбора, и разрушение генов — это лишь один из заключительных этапов в целой серии изменений. Возможно, именно это случилось с генами опсинов, о которых я уже рассказывал раньше, и это же произошло в удивительном случае, связанном с возникновением ископаемого гена в человеческой линии после того, как предки людей и шимпанзе отделились от общего предка.


Человеческий ископаемый ген, о котором я хочу рассказать, называется MYH16. В последовательности гена MYH16 у человека отсутствуют два основания, что нарушает правильное считывание текста (соответствующий участок последовательности представлен на рис. 5.4; место отсутствующих оснований обозначено звездочками). У шимпанзе, горилл, орангутанов и макак этот ген остался без изменений.

Рис. 5.4. Образование ископаемого гена у человека. Показан короткий фрагмент гена миозина MYH16. У человека произошла делеция двух оснований (звездочки), нарушившая считывание кода и вызвавшая ослабление двух челюстных мышц, сильно развитых у наших родственников — человекообразных обезьян. Рисунок Джейми Кэрролл на основании данных из статьи H. H. Stedman et al., 2004, Nature 428:416.


У других приматов белок MYH16 образуется в некоторых мышцах, особенно в височной мышце, охватывающей большую поверхность височной части черепа с обеих сторон. Эта мышца участвует в движениях нижней челюсти при пережевывании пищи. У человека эта часть лица и эта мышца гораздо менее развиты, чем у горилл, шимпанзе и макак. Продукт гена MYH16 представляет собой белок миозин, являющийся составным элементом мышечных волокон. Волокна височной мышцы человека значительно тоньше, чем у других приматов, а более тонкие волокна образуют более слабую мышцу.

Интересная связь между мутацией белка, влияющего на размер мышечных волокон и мышц, и эволюционными изменениями височной мышцы вызывает вопрос, была ли мутация причиной ослабления мышцы или побочным результатом ослабления мышцы, вызванного другими причинами. Однозначно ответить на этот вопрос трудно, но давайте познакомимся с некоторой дополнительной информацией по этому поводу. Известно, что мутации в этом классе белков могут оказывать значительное влияние на состояние мышц. Если примат с тяжелой челюстью (как у человекообразных обезьян и наших с вами предков) сразу лишится мышцы, он не сможет жевать. Если мутация MYH16 сыграла роль в эволюции височной мышцы, скорее всего, мышечная масса сокращалась поэтапно. Мне кажется, что наиболее вероятный сценарий потери функции гена MYH16 напоминает историю с глобинами у ледяных рыб. Это означает, что мышца ослабла в результате других генетических причин, а превращение гена MYH16 в ископаемый ген, скорее всего, было более поздним событием и объяснялось отсутствием потребности в этом гене.

Ископаемые гены как аргумент против «прогресса» и «замысла»

Представленные в этой главе примеры показывают, что создание наиболее приспособленного (будь то древняя рыба, великолепный дельфин, яркий цветок, человек с облегченной челюстью, простые дрожжи или слепой подземный грызун) не обязательно является «прогрессивным», аддитивным процессом. Современные виды оснащены не лучше, чем их древние предки, они просто другие. Зачастую они приобрели некоторое количество новой кодирующей ДНК, но также и потеряли по пути какие-то способности и какие-то гены, иногда — множество генов.

Существование ископаемых генов и утрата генов являются веским доказательством отсутствия какого-либо замысла или намерения в создании видов. Например, эволюция возбудителя проказы противоречит идее о том, что этот патоген создавался по плану. Скорее, этот микроорганизм является упрощенной версией микобактерии, по-прежнему несущей в себе более тысячи бесполезных и поломанных генов — свидетелей прошлого. Точно так же у людей сохранились остатки обонятельной системы, которая когда-то была гораздо чувствительнее, чем сейчас.

Картина приобретений и потерь, представленная в ДНК различных организмов, — такая, какой и следует ожидать, если естественный отбор действует лишь в настоящем времени, ничего не планируя и не загадывая наперед. Естественный отбор не может сохранить то, что сейчас не нужно, и не умеет строить планы на будущее. Потеря генов и возникновение ископаемых генов — это именно то, что и должно происходить при отсутствии естественного отбора. Со временем накапливаются случайные мутации, в конечном итоге разрушающие информацию, записанную в неиспользуемых или ненужных генах.

Более того, исчезновение одинаковых генов у предков организмов, относящихся к самым разным видам, однозначно доказывает, что при отсутствии отбора по какому-либо признаку в ДНК будут снова и снова повторяться одни и те же события. Наглядным подтверждением этого принципа является многократное и независимое разрушение генов коротковолновых опсинов у разных видов животных. Мы расширим этот тезис в следующей главе, посвященной предсказуемости и повторяемости эволюции в целом, и рассмотрим удивительные примеры того, как эволюция воспроизводит саму себя.

Обезьяна ревун, Коста-Рика. Фотография Стивена Холта.

Глава 6 Deja vu. Как и почему эволюция повторяется

Поскольку поток времени бесконечен, а судьба изменчива, не приходится, пожалуй, удивляться тому, что часто происходят сходные между собой события. Действительно, если количество основных частиц мироздания неограниченно велико, то в самом богатстве своего материала судьба находит щедрый источник для созидания подобий…

Плутарх, «Жизнеописание Сертория»

Ярко-зеленые заросли кустарника покрывают изрезанную линию побережья Коста-Рики, а затем сворачивают вглубь материка, туда, где берег реки Сиерпе образует удобную маленькую бухту. Мы уселись в машину и двинулись в тряский путь через плантации пальм к берегу, а там пересели на лодку и поплыли вниз по течению. Широкая река, со всех сторон окруженная бесконечными мангровыми зарослями, впадает прямо в Тихий океан. Поборовшись с волнами в устье реки, мы наконец причалили к берегу на краю Национального парка Корковадо на полуострове Оса — это один из последних обширных участков дикой природы, сохранившихся в Центральной Америке. После долгого насыщенного путешествия мы были совершенно без сил и решили заночевать в темноте и тишине дождевого леса.

Наш заслуженный сон был прерван сигналом к побудке — тяжелыми, низкими гортанными криками шумной стаи ревунов, резвящихся в кронах деревьев. Вот тебе и природная тишина.

У ревунов, чьи голоса разносятся на четыре с лишним километра вокруг, чрезвычайно развитая глотка и гортань, что позволяет им сообщать о своем местонахождении соседним (и не только соседним) стаям (а также туристам). Крик ревуна не спутать ни с чем, однако эти обезьяны обладают и другой способностью, отличающей их от капуцинов, беличьих обезьян и других обезьян Нового Света, также обитающих в дождевых лесах. Ревуны обладают полноценным трихроматическим зрением.

Анализ ДНК ревунов показывает, что они приобрели эту способность примерно таким же путем, как и их дальние родичи из Старого Света, но в другое время и в результате совершенно независимой серии событий. Кроме того, ревуны питаются нежными молодыми листьями, как и другие приматы с трихроматическим зрением. Примеры независимого воспроизведения эволюции обезьян на этом не заканчиваются. У ревунов, как и у их дальних африканских и азиатских родственников, более высокое содержание ископаемых генов обонятельных рецепторов, чем у всех их ближайших родственников из Нового Света. Ревуны тоже частично обменяли свою способность распознавать запахи на способность различать цвета.

Поразительно.

Эволюция цветового зрения, переход к лиственной диете и потеря генов обонятельных рецепторов у ревунов произошли на другом континенте через 20 млн или 25 млн лет после того, как эти изменения произошли у предков африканских и азиатских обезьян. История этих приматов говорит о том, что при одинаковых условиях даже в разных частях света и в разное время некоторые виды животных могут приобретать или терять одинаковые признаки.

Ревун — прекрасный пример распространенного в природе явления, называемого конвергентной эволюцией. У представителей самых разных систематических групп можно найти сходные признаки, возникшие независимым путем. Например, ласты пингвинов, тюленей и дельфинов служат одной и той же цели при плавании, но все эти животные произошли от разных предков, у которых ластов не было. Крылья птерозавров, птиц и летучих мышей также служат примером конвергентной эволюции, как и форма тела ихтиозавров и дельфинов, змей и безногих ящериц. И это лишь некоторые из множества известных примеров. Широкое распространение этого явления показывает, что в одинаковых условиях виды часто находят одинаковый путь адаптации.

Однако в деталях процессы эволюции многих конвергентных структур у разных видов могут различаться. Крылья птиц, летучих мышей и птерозавров различаются по своему строению: в этих трех случаях максимальная поверхность крыла образована разными частями передней конечности. На уровне ДНК за эти различия в структурной организации отвечают разные гены. В случае ревуна и других обезьян (а также во многих других примерах, которые я приведу ниже) замечательно то, что похожие события в эволюции различных видов сопровождаются изменением одних и тех же генов, часто даже одних и тех же оснований в последовательности ДНК. В четвертой главе мы уже видели пример такого точного повторения: у птиц, способных видеть в ультрафиолетовом свете, одно и то же изменение коротковолнового опсина происходило не менее четырех раз. А в пятой главе мы познакомились с пятью группами организмов, у которых ген того же самого опсина был инактивирован в результате мутаций и стал ископаемым геном. Смысл этих примеров в том, что они являются фактическим доказательством повторения эволюционных событий на самом глубоком и основополагающем уровне.

Но это лишь вершина айсберга.

Ниже я приведу много других примеров того, как эволюция воспроизводит саму себя. Некоторые повторяющиеся адаптации вам уже знакомы из предыдущих глав: эволюция нового панкреатического фермента у жвачных животных, появление антифриза у ледяных рыб, а также потеря генов, ответственных за расщепление галактозы, у дрожжей. Далее мы рассмотрим несколько новых признаков, таких как темная или светлая окраска тела, которая не раз возникала одним и тем же способом у совершенно непохожих организмов. Наблюдая, как одинаково развиваются неродственные виды, мы получаем исчерпывающее доказательство того, как естественный отбор, действуя на уровне вариаций ДНК, влияет на их эволюцию.

Способность естественной истории к самовоспроизводству вызывает резонный вопрос — как и почему это происходит. Как я покажу далее, для ответа на этот вопрос нужно учесть такие факторы, как вероятность, время и отбор, а также арифметику больших чисел, определяющую частоту событий в ДНК и в природе вообще. Повторяемость природных событий и лежащая в основе этого явления арифметика составляют главное содержание этой главы и объясняют основные идеи всей книги.

Чтобы лучше понять конвергентную эволюцию, давайте сначала подробнее поговорим об обезьянах ревунах и о том, почему мы полностью уверены в том, что их способности эволюционировали независимо от таких же способностей обезьян Старого Света.

Второе пришествие трихроматических обезьян

Наличие полноценного цветового зрения у ревунов, обнаруженное во время масштабного исследования обезьян Нового Света, оказалось для ученых неожиданностью. Эта способность у ревунов, как и у приматов Старого Света, могла возникнуть в результате реализации одного из двух альтернативных эволюционных сценариев. В первом случае ревуны могли унаследовать цветовое зрение от своего общего предшественника с обезьянами Старого Света. Во втором, который, как я уже говорил, и имел место, ревуны должны были обзавестись цветовым зрением в результате последовательности событий, не связанной с эволюцией обезьян Старого Света.

Откуда мы знаем, какой сценарий правильный?

Допустим, какие-либо два вида организмов имеют общие признаки. Чтобы установить, унаследованы ли они от общего предшественника или появились независимо, нужно посмотреть, как связаны эти виды на эволюционном древе. Отмечая наличие или отсутствие признака на эволюционном древе, можно проследить историю возникновения этого признака. Каждая точка ветвления на древе соответствует общему предку исходящих из этой точки ветвей. Если у всех видов, произошедших от данного предка, этот признак есть, то, скорее всего, предок также обладал этим признаком (рис. 6.1 а). Однако если две ветви, обладающие данным признаком, соединяются с другими ветвями, в которых этого признака нет, то, вероятнее всего, в двух ветвях этот признак появился независимым образом (рис. 6.1 б).

Рис. 6.1. Альтернативные варианты появления общих признаков у разных видов. Разные виды организмов могут обладать общим признаком (звездочка), если они унаследовали его от общего предка (A) или в результате независимой эволюции этого признака у данных видов после их отделения от общего предка (Б). Рисунок Лианн Олдс.


Теперь давайте взглянем на эволюционное древо приматов Старого и Нового Света (построенное на основании наследования SINE, LINE и других последовательностей ДНК), изображенное на рис. 6.2.

Рис. 6.2. Полноценное цветовое зрение возникало у приматов дважды. На основании распределения способности к цветовому восприятию и эволюционных связей между приматами, представленных на этой диаграмме, можно сделать вывод о том, что полноценное цветовое зрение возникало у приматов дважды (стрелки): один раз у общего предка человекообразных и других обезьян Старого Света, второй раз — у ревунов. Из статьи Giladet at., 2004, PloSBiology 2 (1): e5 (с изм.).


Из рисунка следует, что ближайшими родственниками ревунов являются другие обезьяны Нового Света, но ни один из этих видов не обладает полноценным цветовым зрением. Теоретически возможно, что у предшественника обезьян Нового Света цветовое зрение было, но все потомки, кроме ревуна, эту способность потеряли. Однако такой сценарий предполагает лишь одно приобретение и слишком много потерь. Более простое объяснение, подразумевающее гораздо меньшее количество эволюционных изменений, заключается в том, что ревун произошел от предшественника с дихроматическим зрением и самостоятельно приобрел способность различать цвета.

К счастью, чтобы докопаться до истины, мы не обязаны полагаться лишь на информацию, заключенную в эволюционном древе. Удвоение генов оставляет в ДНК свои следы. Анализ последовательности и организации современных генов опсинов в ДНК приматов Старого Света, а также ревунов и других обезьян Нового Света проливает свет на их историю. Из текста ДНК однозначно следует, что удвоение гена опсина у приматов Старого Света и у ревуна — несвязанные события. Мы можем это утверждать, поскольку в этих двух случаях размеры удвоенных фрагментов ДНК разные. У приматов Старого Света вне кодирующей последовательности каждого из двух генов имеются одинаковые последовательности длиной по 236 пар оснований. Это означает, что при создании гена средневолнового опсина была удвоена еще и прилежащая последовательность из 236 пар оснований. А у ревуна к удвоенным генам опсина примыкают гораздо более протяженные некодирующие участки. Такое могло произойти лишь в том случае, если удвоение гена опсина у ревуна произошло независимо от удвоения гена опсина у нашего с вами предка.

Кроме того, дополнительным доказательством независимости двух событий является степень сходства генов в каждой паре. Со временем после удвоения гена в каждой его копии накапливаются мутации. Чем раньше произошло удвоение, тем больше различие между двумя копиями. Так вот, у приматов Старого Света последовательности двух генов опсина различаются более чем на 5 %, тогда как гены ревуна различаются лишь на 2,7 %. Это означает, что удвоение гена опсина у ревуна произошло позднее, чем у приматов Старого Света. Это заключение вполне согласуется с палеонтологическими доказательствами более поздней эволюции обезьян Нового Света, начавшейся после разделения южноамериканского и африканского континентов.

Конвергентная эволюция опсинов ревуна и приматов Старого Света не сводится лишь к удвоению генов. Вспомним, что для полноценного цветового восприятия необходима тонкая настройка опсинов на разные длины волн и что на значение максимума поглощения опсинов MWS и LWS влияют аминокислоты, расположенные в трех ключевых позициях этих молекул. Средне- и длинноволновые опсины ревуна настроены на те же самые длины волн, а в трех ключевых позициях имеют те же самые аминокислотные остатки, что и аналогичные опсины человека и других приматов Старого Света. Это означает, что в ходе эволюции «нового» опсина MWS у ревуна и «нового» опсина MWS у приматов Старого Света произошло три одинаковые замены.

Анализ ДНК свидетельствует о том, что эволюция зрения и обоняния у ревунов шла тем же путем, что и у приматов Старого Света за миллионы лет до этого. Удвоение гена опсина, тонкая настройка ключевых позиций в молекулах опсинов и отмирание генов, ответственных за обоняние, повторились в той же последовательности и где-то с теми же деталями.

Изучение конвергентной эволюции цветового зрения у приматов и восприятия ультрафиолетового света у некоторых птиц показывает, что родственные виды могут приобретать похожие признаки, однако конвергенция ни в коем случае не ограничена степенью родства. Вспомните историю эволюции родопсина, настроенного на восприятие тусклого синего света, у глубоководного угря и у афалины (глава 4), а именно появление трех идентичных аминокислотных остатков в ключевых положениях их опсинов. Одна и та же история, но разные гены и крайне далекие друг от друга виды.

История эволюции опсинов вызывает вопрос более общего плана: насколько часто появление одинаковых признаков у разных видов организмов связано со сходными эволюционными изменениями ДНК? Давайте рассмотрим четыре примера того, как с помощью похожих механизмов с участием одного и того же гена или одних и тех же генов у разных видов и в разное время возникали одинаковые признаки.

Одним путем к одной цели

Задолго до появления у обезьяны колобуса особой пищеварительной системы и способности переваривать листья это же свойство развилось у предка таких обычных жвачных животных, как коровы, овцы и козы. Есть ли какое-то сходство в эволюции пищеварения у обезьян и у коров? Безусловно, есть.

Вспомним, что одним из механизмов адаптации к новому способу питания у колобуса было появление специализированной панкреатической рибонуклеазы, расщепляющей питательные вещества в смеси листьев и бактерий. Этот фермент возник в результате удвоения и тонкой настройки гена, кодирующего обычную рибонуклеазу. У коровы этот ген также удвоился и подвергся тонкой настройке в соответствии с условиями в пищеварительной системе этого животного. Мы знаем, что эти события у обезьян и коров произошли независимо, поскольку удвоение гена рибонуклеазы произошло у всех жвачных, но у ближайших родственников жвачных, таких как гиппопотамы и дельфины, а также у ближайших родственников колобуса ген рибонуклеазы только один. Таким образом, эти группы жвачных животных не могли унаследовать удвоенные гены от общего предшественника.

Кроме того, африканские колобусы — не единственные жвачные обезьяны. В Азии существует еще одна группа жвачных обезьян. Эффектный немейский тонкотел (рис. L цветной вкладки) — находящийся под угрозой вымирания вид обезьян, распространенный во Вьетнаме, Лаосе, Камбодже и Китае, — также имеет удвоенный ген рибонуклеазы.

Жианши Цанг из Университета Мичигана обнаружил, что удвоение гена рибонуклеазы у обезьян происходило в разное время и приводило к образованию разного количества генов (трех у африканских видов, двух у азиатских). Однако впоследствии в ферментах произошло несколько совершенно идентичных изменений. Вероятность случайного совпадения изменений у двух групп обезьян чрезвычайно низка. Гораздо более вероятно, что параллельные изменения в структуре ферментов у обеих групп обезьян являются результатом естественного отбора, настраивавшего ферменты на работу в более кислой среде передней кишки.

Возникновение ископаемых генов и полное исчезновение генов тоже повторяются. В предыдущей главе я рассказывал об избирательной потере функций семи генов метаболизма галактозы у дрожжей S. kudriavzevii. Но существуют еще три вида дрожжей, принадлежащие к разным родам и разделенные миллионами лет эволюции, которые также потеряли все или почти все гены, связанные с метаболизмом галактозы, и больше не могут расщеплять этот сахар. На основании эволюционного родства между дрожжами можно с уверенностью утверждать, что в ходе эволюции эта группа генов независимым образом была потеряна как минимум три раза, а может быть, и больше. Скорее всего, в каждом случае ослабевало влияние естественного отбора, что и приводило к разрушению и исчезновению генов.

Ослабление влияния естественного отбора также объясняет повторяющуюся эволюцию признаков у животных, обитающих в пещерах. Например, известно множество видов пещерных рыб, которые лишились глаз и окраски. Поскольку эти рыбы относятся к разным семействам, куда также входят рыбы, живущие в поверхностных водах и обладающие зрением, становится ясно, что потеря зрения и пигментации происходила в истории многократно. Пещерные рыбы позволяют выяснить, имеют ли эти внешние признаки какие-то более глубокие общие основания.

Не так давно Мередит Протас и Клифф Табин с медицинского факультета Гарвардского университета, Билл Джеффри из Университета Мэриленда и их сотрудники изучили эволюцию альбинизма у слепых рыб, обитающих в поземных водоемах в мексиканских пещерах (рис. 6.3).

Рис. 6.3. Эволюция альбинизма у слепых пещерных рыб. В то время как живущие в поверхностных водах представители вида Astyanax mexicanus выглядят как обычные рыбы, многие их пещерные родственники, например обитатели пещер Молино и Пачон, в ходе эволюции не раз теряли зрение и окраску в результате мутации в одном и том же гене. Фотография любезно предоставлена Мередит Протас и Клиффом Табином из Гарвардского университета.


Эти рыбы (Astyanax mexicanus) принадлежат к тому же отряду, что и пираньи и ярко окрашенный неон-тетра, однако обитатели примерно 30 пещер на территории Мексики потеряли свою окраску. Ученые обнаружили, что в двух исследованных ими популяциях рыб в результате делеции фрагмента ДНК был инактивирован один и тот же ген, ответственный за пигментацию, однако делеции в каждой популяции были разными. Это доказывает, что популяции, населяющие разные пещеры, утратили окраску независимым образом.

Развитие альбинизма у пещерных рыб проще всего объяснить ослаблением естественного отбора. Какая разница, как вы выглядите, если вокруг темно? Однако для многих других животных окраска тела важна для выбора партнера, спасения от врагов и других важных функций, находящихся под влиянием естественного или полового отбора. Один из самых распространенных вариантов окраски — черный. У многих видов мех, чешуя или перья в той или иной степени окрашены в черный цвет. Существуют и вариации внутри одного вида — особи разного пола или из разных популяций могут различаться по количеству черных полос или пятен на теле. Во многих случаях естественный или половой отбор влиял на один и тот же ген, ответственный за окраску тела позвоночных животных.

Например, голубые северные (снежные) гуси бывают либо белыми, либо «голубыми». «Голубой» цвет связан с появлением в перьях черного пигмента (рисунки M и N цветной вкладки).

Окраска гусей меняется в зависимости от места их обитания: голубые гуси чаще встречаются на востоке Канады, а белые — в самой западной части ареала, в Восточной Сибири. Различие в окраске имеет значение при выборе полового партнера. Молодые гуси очень рано запоминают цвет перьев своих родителей и впоследствии предпочитают спариваться с особями того же цвета. За вариации окраски у северных гусей отвечает одно-единственное генетическое различие. Все дело в гене рецептора меланокортина-1 (MC1R). Различие между генами MC1R у белых и голубых гусей состоит всего в одном триплете, кодирующем аминокислоту в позиции 85.

У других птиц вариации последовательности гена MC1R также коррелируют с изменением окраски. Темный и желтый варианты окраски бананового певуна (сахарной птицы) определяются единственным основанием в гене MC1R. Однако эта единственная замена в данном случае происходит в ином положении, чем у голубых и белых северных гусей. Замена еще в одной позиции в данном гене определяет наличие светлого или темного оперения у третьего вида птиц — короткохвостого поморника (рис. O цветной вкладки).

У этих птиц окраска оперения также играет определяющую роль в выборе партнера и находится под влиянием полового отбора. Необыкновенные различия в окраске самцов и самок прекрасных расписных малюров также определяются геном MC1R (рис. цветной вкладки P и Q).

Однако роль гена MC1R в эволюции окраски тела не ограничена миром птиц. Вариации MC1R ответственны за различия между оранжевыми и черными ягуарами, белыми и темными представителями бурых медведей на западе Северной Америки, светлыми и темными ящерицами, а также за варианты окраса домашних собак, кошек и лошадей.

Одним из наиболее изученных примеров влияния гена MC1R на эволюцию диких животных является изменение окраски мешотчатых прыгунов, распространенных в пустынных юго-западных районах США. Во второй главе на примере генетики и эволюции светлых и темных вариантов прыгунов я проиллюстрировал связь между случайными мутациями, отбором и временем. Эти грызуны обитают в песчаных пустынях и на покрытых окаменелой черной лавой участках земли в Аризоне и Нью-Мексико. Соответствующая окраска позволяет этим животным быть менее заметными на фоне светлого песка или черной лавы. Майкл Нахман, Хопи Хекстра и их коллеги из Университета Аризоны показали, что живущие в районе пустыни Пинакате темные прыгуны отличаются от светлых прыгунов четырьмя позициями в белке MC1R. Интересно, что темные прыгуны имеют точно такую же замену в положении 230, что и короткохвостый поморник. Таким образом, мало того что один и тот же ген задействован в эволюции окраски у некоторых видов птиц, рептилий и млекопитающих, в некоторых случаях у разных видов в этом гене произошли совершенно одинаковые замены.

Еще один пример точного повтора эволюционных изменений — изменение окраски ягуарунди и золотистоголовой львиной игрунки. У темноокрашенных ягуарунди в гене MC1R обнаружена делеция 24 оснований. Точно такая же делеция присутствует у золотистоголовых игрунок, у которых, в отличие от других львиных игрунок, все остальное тело черное (цветная вкладка R).

Эволюция жвачных млекопитающих, метаболизм галактозы у дрожжей, альбинизм у пещерных рыб и темная окраска тела у различных птиц, рептилий и млекопитающих — все это иллюстрирует повторяемость эволюционных изменений на фундаментальном уровне, то есть на уровне отдельных генов.

В ранее приведенных примерах конвергентной эволюции опсинов это воспроизведение было настолько точным, что иногда затрагивало одну и ту же пару оснований. В тех случаях, о которых я упомянул только что, изменения воспроизводятся не с такой высокой точностью. Подробное изучение биохимических свойств рибонуклеазы и рецептора MC1R показало, что в каждом из этих белков есть множество различных участков, изменение которых приводит к похожим результатам.

Разница между идентичным воспроизведением эволюции опсинов и не столь точным повторением эволюции других белков показывает, что для одних «проблем» (или адаптаций) эволюция находит множество решений, а для других — лишь одно. Структура опсина такова, что лишь наличие правильных аминокислотных остатков в нескольких ключевых позициях обеспечивает настройку пигмента на восприятие определенной длины волны. Структуру и активность рибонуклеазы и MC1R настроить легче, поэтому существует много разных способов их изменения. Другими словами, в случае некоторых генов и некоторых признаков для получения одного и того же биологического эффекта генетический текст не обязательно должен меняться одинаково.

Более того, оказывается, что в некоторых случаях конвергентная эволюция может начаться из совершенно разных генетических исходных точек.

Разными путями к одной цели

Одним из важнейших изобретений антарктических рыб был антифриз, состоящий из белков с необычной повторяющейся последовательностью всего трех аминокислотных остатков, чаще всего треонин-аланин-аланин или треонин-пролин-аланин. Этот повтор возник из кодирующей последовательности гена пищеварительного фермента. О происхождении антифриза от гена этого фермента можно судить по его некодирующим последовательностям. Непосредственно прилегающая к гену антифриза последовательность ДНК удивительным образом напоминает последовательность гена фермента, что свидетельствует об образовании гена антифриза из фрагмента ДНК фермента.

Арктические рыбы также живут в очень холодной воде и тоже содержат антифриз в крови и в тканях. Белки-антифризы арктических рыб тоже состоят из повторяющихся последовательностей треонин-аланин-аланин или треонин-пролин-аланин. Понятно, что самым простым объяснением такого совпадения было бы появление белка-антифриза у общего предка арктических и антарктических рыб и его наследование обеими группами потомков.

Однако в данном случае сходство антифризов обманчиво.

Антифриз арктических рыб эволюционировал другим путем и в другое время, чем у антарктических рыб. Это подтверждается множеством доказательств. Во-первых, арктические и антарктические рыбы принадлежат к разным ветвям эволюционного древа и относятся к разным отрядам. Во-вторых, понижение температуры воды в Северной Атлантике и в северной части Тихого океана произошло гораздо позднее, около 2,5 млн лет назад, тогда как на юге температура воды понизилась примерно 10–14 млн лет назад. Конечно, сам этот факт не означает, что какие-то антарктические рыбы не могли мигрировать к северу и дать начало арктической ветви. Однако такой сценарий можно исключить, проследив происхождение антифриза по ДНК.

Есть две основные причины считать, что антифриз арктических и антарктических рыб имеет разное происхождение. Во-первых, в ДНК арктических рыб не обнаружено ни малейшего сходства с последовательностью гена пищеварительного фермента, давшего начало антифризу антарктических рыб. Во-вторых, и это главное, эти два антифриза у арктических и антарктических рыб образуются двумя совершенно разными путями. У антарктических рыб последовательности треонин-аланин-аланин или треонин-пролин-аланин закодированы множество раз и разделены последовательностью лейцин-изолейцин-фенилаланин. Именно в этих местах расщепляется синтезируемая белковая последовательность, давая начало отдельным молекулам антифриза. У арктических рыб разделяющие последовательности имеют совсем иное строение и расщепляются другим ферментом. Таким образом, хотя молекулы антифриза у двух групп рыб поразительно похожи, они образуются из белков с разными «разделителями», которые не могут иметь общего происхождения. Эти белки — аналоги, но не гомологи.

Объяснение удивительного сходства последовательностей пептидных антифризов арктических и антарктических рыб заключается в естественном отборе компонентов, предотвращающих образование льда в теле рыбы. Подробные биохимические исследования показали, что действие пептидных антифризов основано на их способности связываться с кристаллами льда и предотвращать их разрастание. Через остатки треонина пептиды связаны с молекулами углеводов, которые, в свою очередь, играют главную роль во взаимодействии с кристаллами льда. Такой простой повтор, как треонин-аланин-аланин, по-видимому, образует оптимальную повторяющуюся структуру для взаимодействия с регулярной повторяющейся структурой кристалла льда. Конвергентная эволюция антифризов арктических и антарктических рыб свидетельствует о том, что для создания антифриза с определенной структурой и функцией природа нашла несколько путей.

Удивительное сходство антифризов при их различном происхождении вызывает вопрос: обязательно ли молекулы с близкими функциями должны иметь сходные последовательности?

Чтобы ответить на этот вопрос, я предлагаю вам сыграть в одну игру. Ниже представлены последовательности четырех небольших природных белков. Посмотрите внимательно на эти последовательности, изображенные с помощью кода, в котором каждая из 20 основных аминокислот обозначается одной буквой.

1. VCRDWFKETACRHAKSLGNCRTSQKYRANCAKTCELC

2. ZFTNVSCTTSKECWSVCQRLHNTSRGKCMNKKCRCYS

3. CRIONQKCFQHLDDCCSRKCNRFNKCG

4. ZPLRKLCILHRNPGRCYQKIPAFYYNGKKKQCEGFTWSGGCGGNSNRFKTIEECRRTCITRKD

Видите ли вы какое-нибудь сходство между этими последовательностями?

Нет?

Не расстраивайтесь, я тоже не вижу, но при этом между ними обязательно должно быть нечто общее.

Суть вот в чем. Четвертый белок в списке принадлежит змее. Я всю жизнь интересовался змеями и всегда разыскивал их, если оказывался в местах, где встречаются любопытные виды. Эта белковая последовательность принадлежит той единственной змее, которая действительно меня напугала. Однажды я посетил небольшой змеиный питомник вблизи озера Баринго в Кении. Один из дрессировщиков с удовольствием продемонстрировал мне очень нервную трехметровую черную мамбу. Змея была настолько крупной и проворной, что я невольно отступил назад, но дрессировщик придвинулся ко мне еще ближе.

Если бы он допустил ошибку, я уже ничего не смог бы вам рассказать. От укуса черной мамбы человек может погибнуть за полчаса. В яде змеи содержатся мощные нейротоксины (под четвертым номером в списке как раз представлена последовательность основного токсина из яда черной мамбы). Смертельное действие этого токсина основано на блокировании так называемых калиевых каналов. Эти каналы играют важнейшую роль в проведении электрических сигналов в нейронах и мышцах. Когда их функция блокирована, нарушается работа нервов и мышц. После укуса черной мамбы у людей обычно прекращается нервная и мышечная активность, и без немедленного введения противоядия люди умирают от остановки дыхания.

Три других белка в списке тоже блокируют калиевые каналы и тоже обнаружены в различных ядах. И вот что забавно: первый принадлежит морскому анемону (актинии), второй — скорпиону, а третий — морской улитке-конусу. Все четыре вида животных относятся к разным типам: анемон — кишечнополостное, скорпион — членистоногое, конус — моллюск, а мамба — позвоночное. Представленные в списке токсины эволюционировали независимо друг от друга и имеют разное строение, но функция у них одна и та же — перекрывание калиевых каналов жертвы. Это разные молекулы, имеющие разное происхождение, но общее смертоносное назначение.


Я очень надеюсь, что рассказ об эволюции этих токсинов, а также другие примеры повторения эволюционных событий вас не просто впечатлили, но по-настоящему потрясли. Мне кажется, что они принадлежат к числу самых ярких и убедительных свидетельств того, как действует эволюция в природе. В этих примерах сочетаются два важнейших элемента — повторяемость событий и совпадение в деталях.

Есть старая латинская поговорка: repetitio est mater doctrinae, повторенье — мать ученья. А что верно для обучения, то верно и для науки. Примеры адаптации отдельных видов, безусловно, весьма информативны, но повторение эволюционных изменений, иногда в мельчайших деталях, говорит о том, что под влиянием похожих факторов получаются похожие результаты. Эволюция обладает замечательной способностью воспроизводиться.

До сих пор мой рассказ о повторении эволюционных событий сводился к рассмотрению вопроса «как»: каким образом приобретаются похожие способности или теряются определенные признаки. Но мы пока ничего не сказали о том, почему это происходит. Почему эволюция воспроизводит саму себя? Ответ складывается из трех основных составляющих — вероятности, отбора и времени, вступающих в игру по законам простейшей математики эволюции (см. главу 2). Возможно, эти арифметические выкладки покажутся (или уже показались) вам лишними и непонятными, однако взаимосвязь этих трех элементов и их влияние на информационное содержание ДНК полностью объясняют, почему одни и те же события в естественной истории повторяются вновь и вновь.

Вероятность, необходимость и (вос)создание наиболее приспособленного

Во второй главе, когда мы знакомились с основными движущими силами эволюции, у нас еще не было возможности проследить за ходом эволюции на уровне ДНК. Теперь мы знаем, что эволюция опсинов, рибонуклеаз, рецептора MC1R, ферментов, ответственных за расщепление галактозы, и т. д. включала повторяющиеся и иногда совершенно идентичные изменения соответствующих генов. То, что во второй главе было «просто» теорией, мы подтвердили примерами эволюции видов на самом фундаментальном уровне — на уровне отдельных элементов ДНК.

Значение открытий, о которых идет речь в этой главе, можно заключить в ряд общих тезисов, касающихся основных факторов эволюции: i) Стечением времени ii) идентичные или эквивалентные мутации случайным образом возникают снова и снова, iii) причем их судьба (сохранение или устранение) зависит от действия отбора на тот признак, на который эти мутации влияют.


Оставшуюся часть главы я посвящу рассмотрению этих утверждений, используя реальную математику мутаций, реальные биологические факты и реальные примеры из этой и предыдущих глав, чтобы показать, почему эволюция может повторяться и повторяется. Расчеты и закономерности, выявленные на основании анализа ДНК, не оставляют сомнений в том, что причиной и исчерпывающим объяснением биологической эволюции является сочетание случайных мутаций, естественного отбора и фактора времени.

За доказательствами мы с вами обратимся к миру очень больших чисел. Предупреждаю, что по пути вам может прийти в голову мысль: «Это невозможно!» На самом деле противники дарвиновской теории эволюции достаточно часто привлекают математический псевдоанализ, чтобы обосновать ее «невозможность». Однако в их аргументах всегда остается неучтенным один или несколько важных факторов. Мы увидим, что при учете всех факторов оказывается, что эволюция посредством специфических отбираемых изменений в ДНК не просто возможна, а возможна «с избытком».

Случайность: «идентичные или эквивалентные мутации случайным образом возникают снова и снова»

Давайте начнем с фактов, касающихся эволюции ультрафиолетового зрения у птиц. В четырех разных отрядах птиц есть и те, кто видит ультрафиолетовый свет, и те, кто видит только фиолетовый. Это означает, что переход от одной способности восприятия к другой происходил независимо не менее четырех раз. На способность воспринимать ультрафиолетовый или фиолетовый свет влияет аминокислота, находящаяся в положении 90 в последовательности коротковолнового опсина. Птицы, в опсине которых в этом положении находится остаток серина, настроены на восприятие фиолетового света, а те, у которых в этом месте находится остаток цистеина, — на восприятие ультрафиолетового света.

Эти аминокислотные остатки кодируются основаниями ДНК, расположенными в позициях 268–270 в последовательности гена коротковолнового опсина птиц. Более точный анализ показывает, что наличие в этом участке серина или цистеина определяется лишь одним основанием, находящимся в положении 268 (табл. 6.1).


Таблица 6.1. Повторяющаяся эволюция УФ-чувствительного опсина

Зебровая амадина, серебристая чайка, нанду и волнистый попугайчик принадлежат к разным отрядам. Основное различие между их опсинами состоит в замене A на T в положении 268, которое произошло в ходе эволюции как минимум четыре раза.

Какова вероятность того, что одна и та же конкретная мутация произойдет у разных видов животных? Пришло время арифметики.

Вероятность мутации конкретного основания у большинства животных — от рыб до людей — составляет примерно 1 на 500 000 000 оснований ДНК. Это означает, что замена A в положении 268 в одной копии гена опсина SWS в среднем происходит у одного птенца из 500 млн. В организме каждый ген представлен в двух копиях, поэтому средняя[15] вероятность такого события увеличивается до 1:250 млн птенцов. Однако вариантов замены в этой позиции три: основание A может быть заменено на T, C или G. В соответствии с генетическим кодом только замена A на T приведет к образованию цистеина и к появлению у птиц способности воспринимать ультрафиолетовый свет. Если вероятность всех этих замен одинакова (она неодинакова, но мы с вами проигнорируем существующее небольшое различие), то лишь в одном случае из трех произойдет необходимый переход. Замена основания A на основание T в данной позиции происходит примерно у одного из 750 млн птенцов.

Вам кажется, что это слишком редкое событие?

Но мы пока не учли количество птенцов, ежегодно появляющихся на свет. По данным многолетних исследований, популяции многих видов птиц насчитывают от одного до 20 млн особей и более. За год птицы такого многочисленного вида, как серебристые чайки, производят на свет не менее 1 млн птенцов (и возможно, эта цифра сильно занижена). Поделим это значение на частоту мутаций и получаем, что замена серина на цистеин в данной позиции происходит один раз в 750 лет. По сравнению с человеческой жизнью это может показаться очень долгим сроком, но сейчас мы с вами должны настроиться на иную временную шкалу. Только у одного этого вида птиц за какие-то 15 тыс. лет данная мутация может независимо произойти 20 раз.

Четыре отряда, к которым принадлежат перечисленные виды, являются древними — у их предков были десятки миллионов лет на то, чтобы выработать ультрафиолетовое или фиолетовое зрение. При такой вероятности мутаций замена A на T только у одного вида чаек за миллион лет произошла свыше 1200 раз. Улавливаете идею?

А если эволюционное изменение не должно быть таким точным? Я рассказывал, что за темную окраску перьев у северного гуся, короткохвостого поморника, бананового певуна и других животных отвечают разные мутации гена MC1R (я уверен, что существует великое множество животных, окраска которых определяется вариантами гена MC1R, но здесь привожу лишь несколько хорошо изученных биологами примеров).

Из имеющихся данных понятно, что темная окраска меха, перьев или чешуи возникает в результате как минимум десяти разных мутаций MC1R. При наличии десяти позиций для мутаций и при одинаковой вероятности мутаций (она одинаковая, поскольку все участки ДНК подвержены мутациям в равной степени) получаем, что вероятность появления темной окраски, связанная с изменениями гена MC1R, в десять раз выше, чем вероятность конкретной точечной замены в гене коротковолнового опсина. Таким образом, темную окраску будет иметь один детеныш из 75 млн. Частота появления темной окраски в популяции зависит от плодовитости вида. У тех видов, которые производят 750 тыс. детенышей в год, новый темный детеныш появляется каждые 100 лет (10 тыс. новых черных вариантов за 1 млн лет). У тех видов, которые производят ежегодно 7,5 млн детенышей, черный детеныш появляется один раз в десять лет. Даже у малочисленных видов, производящих не более 75 тыс. детенышей в год, детеныш с новым вариантом черной окраски появляется один раз в 1 тыс. лет.

Теперь вас не удивляет, что черные мыши, черные птицы и черные ящерицы имеют мутации в одном и том же гене? Или что некоторые виды животных имеют одну и ту же замену в гене MC1R?

А как обстоит дело с ископаемыми генами? Легко ли они образуются? Они образуются очень легко. В то время как для изменения функции гена обычно существует лишь несколько возможностей, для нарушения функции гена таких возможностей множество. Примерно 5 % всех точечных мутаций приводят к прерыванию последовательности гена. Кроме этих простых «опечаток» вставки и делеции не кратного трем числа оснований также приводят к нарушению считывания генетической информации. Небольшие вставки и делеции встречаются достаточно часто. На основании этих данных можно сказать, что испортить ген примерно в 50 или 100 раз «легче» (то есть вероятнее), чем произвести специфическую точечную мутацию. Применяем уже знакомую нам арифметику и получаем, что одно животное из примерно 2 млн родится с новым потенциальным ископаемым геном. Из данных табл. 6.2 видно, что частота возникновения ископаемых генов и гораздо более специфических мутаций зависит от скорости размножения.

Таблица 6.2. Частота появления похожих мутаций в одном и том же гене за 1 млн лет

А теперь вдумайтесь: по оценкам ученых, на Земле сегодня существует около 10 тыс. видов птиц. Из цифр в таблице абсолютно ясно, что одни и те же мутации повторяются у всех видов птиц, за исключением самых редких, и возникали несчетное количество раз у их вымерших предков.

Но такая картина вовсе не ограничена миром птиц. Многие другие группы животных имеют сравнимую численность популяции и скорость воспроизводства, а некоторые даже более плодовиты. Мы не будем вновь заниматься вычислениями, чтобы удостовериться, что в гигантских популяциях рыб, насекомых или ракообразных некоторые мутации повторяются еще чаще.

Итак, мутации происходили и происходят в избытке. Возникает другой вопрос: останется ли в популяции новая, потенциально «полезная» мутация или исчезнет, потеряется? Здесь в дело вступает естественный отбор.

Отбор: «их судьба зависит от действия отбора на тот признак, на который эти мутации влияют»

В четырех предыдущих главах мы говорили о сохранении, расширении, модификации или разрушении заключенной в ДНК информации в результате действия или бездействия естественного отбора. Я рассказывал о возможной судьбе генов в трех разных ситуациях. В главе 3 мы познакомились с действием очищающего отбора, сохраняющего информацию ДНК на протяжении миллиардов лет в условиях постоянного потока мутаций. В главе 4 мы оценили положительную роль естественного отбора в удвоении генов и тонкой настройке генов, в результате чего на основе «старых» генов создается новая информация и новые признаки. В главе 5 мы увидели, что в отсутствие естественного отбора, сохраняющего гены, текст ДНК разрушается и стирается. А в данной главе мы проследили за тем, как одинаковые или эквивалентные изменения в ДНК вновь и вновь отбираются (или допускаются, если естественный отбор ослабевает).

На фундаментальном уровне, то есть на уровне ДНК, отбор контролирует относительную успешность распространения альтернативных форм отдельных генов. Допустим, мы имеем две последовательности ДНК, A и B, различающиеся по одной или нескольким позициям. В зависимости от условий отбора существуют три варианта развития событий. Если последовательность A лучше обеспечивает выживание или репродуктивный успех организма, чем B, преимущество оказывается на стороне A. Напротив, если последовательность B обеспечивает лучшие показатели выживаемости и воспроизводства по сравнению с последовательностью A, преимущество получает B. Третья возможность заключается в том, что ни одна из последовательностей не дает преимущества или что они определяют признак, который уже не важен для выживания и воспроизводства. В этом случае частота встречаемости вариантов A и B будет колебаться случайным образом — «дрейфовать».

Таким образом, каждую новую мутацию ожидает один из этих трех вариантов развития событий. Она может активно сохраняться, активно удаляться или оставаться без внимания со стороны естественного отбора. Например, если у птицы есть ген коротковолнового опсина с триплетом AGC в положениях 268–270, она, скорее всего, видит в фиолетовом диапазоне спектра. Теперь рассмотрим девять вариантов изменения этой последовательности в результате мутаций каждого из трех оснований триплета.

Не будь естественного отбора, в опсинах птиц существовали бы все варианты замен. Однако исследование 45 видов птиц из 35 семейств показало, что у всех видов в данном положении находится либо серин, либо цистеин. Вероятность того, что это результат простой случайности, пренебрежимо мала. Значит, в ходе эволюции птиц все другие возможные изменения в этой позиции вновь и вновь отсеивались. Такова сила естественного отбора.

Статистический анализ помогает выявить неслучайный характер последовательностей ДНК, но математика — не единственный способ понять, как действует естественный отбор. Лабораторные эксперименты и изучение физиологии видов дают дополнительную информацию, которая в сочетании с текстом ДНК позволяет составить более полную картину. В данном случае нам известно, что птицы с цистеином в определенном положении способны видеть в УФ-диапазоне спектра, тогда как птицы с серином в этой позиции не воспринимают ультрафиолетовый свет. Единственным объяснением того, что на этом месте стоит только серин или цистеин, является влияние естественного или полового отбора. А лучшее объяснение многократного появления цистеина в этой позиции — что время от времени возникают сходные условия, при которых птицам из разных видов, семейств и отрядов становится выгодно видеть в ультрафиолетовом свете.

Точно так же лучшим объяснением конвергентной эволюции трихроматического зрения у обезьян ревунов, рибонуклеазы у жвачных животных, темной окраски у птиц, млекопитающих и рептилий, антифриза у рыб и мощных нейротоксинов у различных животных является сходство условий отбора, способствующего появлению похожих признаков.

Хотя преимущества антифриза и смертоносных токсинов, убивающих добычу, очевидны, эволюция этих способностей показывает, что отбор работает с тем материалом, который есть под рукой. Отбор благоприятствовал появлению двух практически идентичных вариантов антифриза из двух совершенно непохожих фрагментов ДНК, а также смертельных токсинов из разных исходных материалов. Толчком к изобретению здесь, безусловно, послужила необходимость, но закрепились эти изобретения благодаря совокупному действию случайных мутаций и естественного отбора.

Однако если в результате изменения образа жизни какой-либо признак становится ненужным, естественный отбор остается слеп к мутациям в соответствующих генах. Мутации, разрушающие гены, неизбежны и могут появиться в любом месте текста ДНК. Мы видели, что ген опсина SWS разрушался не менее пяти раз в разное время и пятью разными способами у разных позвоночных животных. У дрожжей трижды происходило разрушение семи генов, составляющих путь метаболизма галактозы. Похожие условия (отсутствие необходимости) снова и снова приводили к сходным результатам.

Не всякая потенциально «полезная» мутация успевает распространиться по всей популяции. На самом деле в большинстве случаев новые мутации теряются случайным образом, прежде чем успевают достичь значимой частоты. Лишь некоторые новые мутации будут поддержаны отбором — в зависимости от того, насколько важные преимущества они обеспечивают. Данные в табл. 6.2, показывают, что высокая частота мутаций предоставляет эволюции широкие возможности, однако эволюция использует лишь некоторые из них.

Важно подчеркнуть, что условия жизни представителей одного и того же вида могут различаться, поэтому одна и та же мутация в одних местах может распространиться, в других оказаться отбракованной, а в третьих остаться без внимания со стороны естественного отбора. Это приводит к тому, что представители некоторых видов, таких как мешотчатые прыгуны, ягуары или северные гуси, могут различаться по многим признакам. Я рассказывал о частоте появления новых мутаций, но на самом деле в популяции обычно присутствуют одновременно две или несколько альтернативных форм генов. И в таком случае эволюция заключается не в «ожидании» новых мутаций, а в повышении или понижении частоты встречаемости альтернативных форм в ответ на изменение внешних условий. Как мы видели в главе 2, временная шкала действия отбора такова, что признак может быстро распространиться или быстро исчезнуть.


Почти 2 тыс. лет назад писатель и философ Плутарх в «Жизнеописании Сертория» очень близко подошел к определению природы эволюции и предсказал возможность повторения исторических событий (см. цитату в начале главы). Он правильно подчеркнул длительность временного интервала («поток времени бесконечен»), фактор вероятности («судьба»), большое количество и разнообразие материала («количество основных частиц мироздания неограниченно велико») и пришел к выводу, что исторические события должны повторяться («часто происходят сходные между собой события» и «созидание подобий»).

Плутарх умело описал роль вероятностного измерения в истории, но ничего не сказал о детерминистском аспекте эволюции — о естественном отборе. Среди множества возможных случайных событий в ДНК естественный отбор отсеивает большинство изменений и способствует распространению лишь немногих из них. Создание наиболее приспособленного — это не дело случая, а, как более 30 лет назад сформулировал известный биолог Жак Моно, результат случайности и необходимости. Повторяющаяся эволюция признаков является результатом совокупного влияния двух факторов — вероятности эквивалентных мутаций и сходства условий отбора.

Мы с вами уже продвинулись далеко вперед по сравнению с теоретическими подсчетами из главы 2. Тем не менее вы вполне можете поинтересоваться: что ж, с мышами, дрожжами и попугаями мы разобрались, но как обстоит дело с людьми?

Власть случайности и необходимости простирается не только на минувшие эпохи и «низшие» виды организмов. Мутации и естественный отбор продолжают действовать в реальном времени, в том числе и на нас с вами. Об этом мы и поговорим в следующей главе.

Очень ядовитый орегонский (желтобрюхий) тритон. Фотография Стивена Хольта.

Глава 7 Наша плоть и кровь. Гонка вооружений, человеческая раса и естественный отбор

Смертельные враги человека — это не его собратья с другого континента или другой расы; это проявления внешнего физического мира, которые ограничивают возможности и влияние человека, болезнетворные микроорганизмы, которые на него нападают, и одомашненные растения и животные, а также насекомые, которые переносят этих микробов.

У. К. Олли. «Социальная жизнь насекомых» (1939)

Говорят, что чаще всего перед смертью люди произносят следующие слова: «Эй, подержите мое пиво и смотрите, что сейчас будет!»

Возможно, то же самое сказал один несчастный в 1979 г. в Орегоне. Прилично выпив в дружеской компании, этот здоровый 29-летний парень проглотил на спор 10-сантиметрового тритона. Через десять минут у него онемели губы. Потом он почувствовал оцепенение и слабость и сообщил друзьям, что умирает. Он отказался ехать в больницу, и вскоре у него остановилось сердце. Работу сердца удалось восстановить, но вся другая медицинская помощь оказалась бесполезной, и бедняга умер менее чем через сутки. За то, что этот человек был первой и пока единственной жертвой яда тритона, а также за то, что он добровольно избавил человечество от своих генов, я номинирую этого отважного гурмана на Дарвиновскую премию[16].

Кроткие, милые и изящные тритоны ни у кого не вызывают страха. Однако желтобрюхий орегонский тритон (Taricha granulosa) является исключением. В его коже содержится столько тетродотоксина (TTX), что его достаточно, чтобы убить несколько человек. TTX — мощный блокатор ионных каналов еще одного типа — натриевых каналов, которые необходимы для проведения нервного импульса. TTX вызывает паралич, нарушает дыхательную функцию и работу сердца и даже в небольших дозах приводит к смерти. Этот токсин стал широко известен в связи с популярностью такого азиатского блюда, как рыба фугу, в которой также содержится довольно много TTX. Заплатите 400 долларов за порцию, и имеющий специальное разрешение повар-эксперт приготовит вам этот деликатес таким образом, что вы сможете насладиться изумительным (как утверждают) вкусом, не наглотавшись яда. Тем не менее с 1974 по 1983 г. в Японии было зарегистрировано 646 случаев отравления фугу, причем 179 из них оказались смертельными. Я был в Японии и советую вам лучше попробовать терияки и темпуру.

Зачем тритону с массой тела не более 20 граммов носить в себе столько яда, что им можно убить 90-килограммового мужчину? Тот парень из Орегона стал жертвой собственной глупости и своеобразной «гонки вооружений» в живой природе. Желтобрюхий тритон пребывает в состоянии непрерывной войны с подвязочной змеей Thamnophis sirtalis. Если тритона проглотит лягушка-бык или еще кто-нибудь, он выживет — единственным хищником, устойчивым к его яду, является подвязочная змея.

Отдельные экземпляры змей различаются по чувствительности к яду, а отдельные экземпляры тритонов — по количеству вырабатываемого ИХ. Кроме того, разные популяции змей и тритонов характеризуются разной степенью устойчивости и ядовитости соответственно. Такая ситуация создает условия для «коэволюционной» гонки вооружений; при этом естественный отбор благоприятствует появлению все менее восприимчивых к яду змей и все более ядовитых тритонов. Эскалация гонки вооружений в ходе эволюции приводит к появлению чрезвычайно ядовитых тритонов, легко убивающих других хищников, и невосприимчивых змей, способных переварить ядовитых тритонов.

Такая гонка вооружений — пример эволюции в ускоренном режиме. Активный отбор с обеих сторон ускоряет эволюционные изменения, что позволяет биологам изучать животных в процессе их эволюции.

Все змеи, пытающиеся переварить тритона, демонстрируют некоторые признаки отравления TTX: они не могут держать голову, становятся пассивными и не способны управлять своим телом. В лабораторных экспериментах большинство змей выпускают проглоченных тритонов и потом выздоравливают. Но даже самые крупные змеи, которым удается проглотить тритона целиком, иногда оказываются парализованными и погибают. И лишь немногие переваривают тритонов без вреда для собственного здоровья.

Возможно, вас заинтересует вопрос: почему змеи все же охотятся на такую опасную добычу? Ответ очевиден для каждого, кто когда-либо голодал. Приходится выбирать между голодом и недомоганием. Змеи с более высоким порогом чувствительности могут питаться тритонами, а с более низким — не могут. Да, змея может отравиться, но это лучше, чем остаться голодной. И, поскольку устойчивость передается по наследству, потомки более устойчивых особей также будут иметь это «преимущество» над потомками менее устойчивых особей. Это как салат из желе и зефира на пикнике. Меня от него тошнит, но зато редкие любители могут наконец съесть столько, сколько захотят.

Если бы тритоны или фугу составляли важный элемент нашего рациона питания, мы, возможно, также вступили бы с ними в гонку вооружений. К несчастью для того парня из Орегона, это не так. Однако мы, люди, находимся в непримиримой схватке с другими смертельными врагами. Некоторые баталии оставили заметный след в геноме отдельных групп населения, а какие-то еще не выиграны.

В этой главе я хочу рассказать о том, какие эволюционные процессы происходят с человеком и оставляют следы в нашей крови, плоти и ДНК. Сначала мы посмотрим, как физическая среда влияет на нашу эволюцию и генетику. Затем поговорим о том, каким образом гонка вооружений с различными инфицирующими агентами повлияла на историю человечества и человеческий геном. Мы с вами являемся потомками наиболее приспособленных — тех, кто смог пережить малярию, чуму, оспу и всевозможные другие напасти, и некоторые из наших генов хранят следы этих событий. Наконец, я расскажу о том, как в организме человека, также в результате эволюционного процесса, возникают раковые опухоли и как понимание механизмов этого процесса помогает создавать новое оружие для борьбы с раком. На этих примерах мы еще раз убедимся в том, что естественный отбор проявляется всякий раз, когда возникают различия между особями и начинается борьба за существование. Мы также увидим, что мутации и отбор — это отнюдь не «сухая теория», а по-прежнему вопрос жизни и смерти.

Человек против солнца

Одно из наиболее явных различий между людьми из разных частей света заключается в цвете кожи. Является ли цвет кожи продуктом эволюции под действием естественного отбора? Или, напротив, цвет кожи — это «всего лишь» отражение родства людей, живущих в одном и том же регионе?

Эти вопросы интересовали людей на протяжении долгого времени. Теории о значении цвета кожи человека стали появляться еще до Дарвина. Во время работы над книгой «О происхождении видов» Дарвин ничего не знал о том, что примерно за 40 лет до этого американский врач Уильям Чарльз Уэллс удивительно четко сформулировал суть принципа естественного отбора. Более того, он связал естественный отбор с некоторыми факторами, влияющими на разнообразие признаков в человеческой популяции.

Уэллс родился в 1757 г. в Южной Каролине в семье иммигрантов из Шотландии. Родители отправили его учиться в Шотландию, где в возрасте 13 лет он поступил в Университет Эдинбурга, но уже в 1771 г. вернулся в Чарльзтаун, чтобы брать уроки у доктора Александера — известного энтузиаста-ботаника и приверженца идей Карла Линнея. После окончания учебы Уэллс начал работать терапевтом, но наибольших успехов он достиг в исследованиях в области физиологии. Круг его интересов был широк: от механизма сокращения мышц до восстановления зрения. Он первым правильно объяснил механизм образования росы, за что Лондонское королевское общество вручило ему медаль Румфорда.

В 1813 году он написал статью, которая в стиле того времени была озаглавлена «Доклад о женской особи белой человеческой расы, часть кожи которой напоминает кожу негра». Статья была опубликована только в 1818 г., уже после смерти автора, в составе более полного труда, включавшего также его автобиографию (рис. 7.1).

Рис. 7.1. Фронтиспис брошюры Уильяма Чарльза Уэллса, опубликованной после его смерти в 1818 г Уэллс первым правильно изложил идею естественного отбора. Текст на странице:

Два эссе. Первое — «О едином зрении двумя глазами», второе — «О росе». Письмо к достопочтенному Ллойду, лорду Кениону, и Доклад о женской особи белой человеческой расы, часть кожи которой напоминает кожу негра, с некоторыми наблюдениями о причинах различия цвета и формы людей белой и черной расы. Написано покойным Уильямом Чарльзом Уэллсом, доктором медицины, членом Королевского общества. А также Воспоминания о его жизни, изложенные им самим.

Лондон. Отпечатано для Арчибальда Констабля и Ко, Эдинбург. 1818.

Фотография любезно предоставлена библиотекой Университета Висконсина.


Уэллс не только сообщил о своих открытиях, но сделал также «Некоторые наблюдения о причинах различия цвета и формы людей белой и черной расы».

Уэллс отмечал, что «негры и мулаты» обладают иммунитетом против некоторых тропических болезней. Он также обратил внимание на то, что животные каждого вида в какой-то степени различаются и что производители улучшают свойства породы одомашненных животных с помощью селекции. А затем он сделал тот же шаг, что и Дарвин 40 лет спустя, и отметил, что все, чего производители добиваются искусственно, «по-видимому, с той же эффективностью, хотя и более медленно, осуществляется в природе, что выражается в формировании разнообразия людей, наиболее приспособленных для жизни в той стране, которую они населяют. В случайном разнообразии, которое проявлялось у первых разрозненных обитателей Центральной Африки, находились такие, которые лучше остальных переносили местные болезни. Эта раса впоследствии разрослась, а другие исчезли; не только из-за неспособности противостоять болезням, но и из-за неспособности выдержать соперничество со своими более сильными соседями. Мне кажется очевидным, что цвет кожи представителей наиболее сильной расы был темным. Но возможность возникновения различных форм продолжала существовать, поэтому со временем появлялись все более и более темные расы, а поскольку самый темный цвет кожи лучше всего соответствовал климату этих мест, он стал наиболее распространенным, если не единственным, цветом кожи в тех конкретных местах, откуда он произошел».

Дарвин узнал о работе Уэллса через несколько лет после публикации книги «О происхождении видов». В более позднем издании Дарвин привел обзор многих трудов на тему эволюции, предшествовавших выходу «Происхождения видов», в виде «Исторического наброска». В четвертом издании своей книги, увидевшем свет в 1866 г., Дарвин писал о том, что Уэллс «отчетливо» распознал «принципы естественного отбора» и что в трудах Уэллса «существование естественного отбора было признано впервые». Дарвин был прав в том, что отмечал заслуги Уэллса, но был ли Уэллс прав в своих суждениях относительно влияния естественного отбора на цвет кожи? Чтобы оценить справедливость гипотезы Уэллса, нужно познакомиться с законами физиологии и генетики, которые определяют цвет кожи, и проанализировать гены представителей различных этнических групп.

Цвет кожи (и волос) в первую очередь определяется относительным содержанием пигмента меланина, синтезируемого специализированными клетками кожи, называемыми меланоцитами. Процесс образования меланина изучен достаточно хорошо, а ключевой элемент этого процесса нам с вами уже знаком — это рецептор меланокортина-1 (MC1R), ответственный также за окраску меха, перьев и чешуи животных. Синтез меланина контролируется гормоном гипофиза, называемым α-меланоцит-стимулирующим гормоном (α-MSH), который связывается с MC1R меланоцитов и стимулирует образование меланина. Затем меланин из специализированных клеток переносится к клеткам кожи и волос.

Другой путь синтеза меланина стимулируется ультрафиолетовым излучением. Ультрафиолет способствует синтезу MC1R и α-MSH, что в свою очередь приводит к повышению уровня синтеза меланина. Именно это происходит в нашей коже, когда мы загораем.

Пигмент меланин — природный экран, защищающий нас от солнца. Он очень эффективно поглощает солнечный свет с разной длиной волны, включая ультрафиолетовую составляющую. Ультрафиолет оказывает пагубное действие на клетки. Хуже того, он действует непосредственно на ДНК и вызывает изменения, повреждающие заключенную в ней информацию. Таким образом, ультрафиолет — это мощный мутаген. Химические вещества, используемые в составе искусственных солнцезащитных кремов, подбирают по их способности поглощать ультрафиолетовое излучение. Однако важно знать, что ультрафиолет не только вреден, но и полезен. Он необходим для образования в коже витамина D3, который играет важную роль в усвоении кальция, а кальций в свою очередь необходим для образования и сохранения костной ткани. При недостаточности витамина D развивается остеопороз, а при крайней недостаточности — рахит. Вот почему для предотвращения недостаточности витамина D его иногда добавляют в молочные продукты.

Количество ультрафиолетового излучения, достигающего поверхности земли, в разных регионах разное. Интенсивность излучения и его влияние на человека зависят от ряда факторов. К ним относится длина пути, пройденного излучением через слои атмосферы (этот параметр в свою очередь зависит от времени года, времени суток и географической широты), высота над уровнем моря, содержание газов в атмосфере, а также отражающие свойства поверхности (наличие снега, воды и т. д.). Наиболее высокое содержание ультрафиолетовой составляющей в солнечном свете имеет место в пределах 30 градусов широты по обе стороны от экватора. А вот зимой в Бостоне солнечного света недостаточно, чтобы запустить синтез витамина D в коже.

Недавно Нина Яблонски и Джордж Чаплин из Калифорнийской академии наук обнаружили тесную связь между уровнем ультрафиолетовой радиации и вариациями в пигментации кожи людей в разных регионах мира. Являются ли внешние условия причиной различий в цвете кожи? И если это так, откуда нам известно, что цвет кожи находился под влиянием естественного отбора?

Чтобы ответить на эти вопросы, логичнее всего начать с анализа генов MC1R у светлокожих и темнокожих индивидов. Светлокожие жители Северной Европы, такие как шотландцы или ирландцы, часто имеют рыжие волосы и веснушки, а их кожа гораздо чувствительнее к солнечному свету, чем у более темнокожих людей. Анализ наследования цвета кожи и волос показывает, что он имеет непосредственное отношение к вариациям гена MC1R как у людей, так и у животных. Рыжий цвет волос европейцев и их предков практически всегда связан с рядом специфических мутаций гена MC1R, вызывающих замену одной аминокислоты на другую. У европейцев и азиатов уже обнаружено 13 различных вариантов гена MC1R, десять из которых вызывают изменения в соответствующем белке, а три оставшиеся ничего не меняют (они являются синонимичными).

Напротив, у африканцев обнаружено пять вариантов гена MC1R, и все они являются результатом синонимичных мутаций. Различное соотношение несинонимичных и синонимичных замен в гене MC1R у людей неафриканского (10:3) и африканского (0:5) происхождения является статистически значимым и не может быть случайным. Гораздо более вероятно, что что-то препятствовало возникновению замен в гене MC1R у африканцев. И этим чем-то был, конечно же, естественный отбор. Мутации в гене MC1R, безусловно, случались. Об этом можно судить по наличию пяти синонимичных вариантов. Но малочисленность мутаций у африканцев и их синонимичный характер позволяют предположить, что естественный отбор поддерживал высокий уровень синтеза меланина. И это объяснение выглядит очень разумным, поскольку меланин выполняет важную защитную функцию в регионах с высокой интенсивностью солнечного света и ультрафиолетового излучения.

Таким образом, Уэллс был прав, предполагая, что темный цвет кожи «лучше подходит» африканцам.

Поскольку европейцы так разнородны, а кожа у них более светлая, возникает вопрос, связано ли это с отбором индивидов с более светлой кожей или с ослаблением отбора индивидов с высоким уровнем продукции меланина. В настоящий момент существуют весомые аргументы в пользу обеих теорий. В северных широтах естественный отбор индивидов с высоким уровнем продукции меланина может ослабевать. Однако, поскольку поглощение определенного количества ультрафиолета необходимо для стимуляции синтеза витамина D, возможно, светлая кожа является адаптацией к жизни в регионах с меньшей интенсивностью солнечного света. Так или иначе, эволюция цвета человеческой кожи и гена MC1R говорит о том, что по мере расселения людей по миру условия отбора изменялись, причем количество и качество солнечного света были лишь одной из переменных.

Другим важным фактором, влияющим на историю развития человечества, были и остаются различные болезнетворные организмы, специфические для конкретных регионов. Уэллс предположил, что, поскольку темнокожие люди имеют иммунитет к определенным заболеваниям, причиной этого преимущества мог быть темный цвет кожи. Мы увидим, что данное предположение ошибочно, однако наблюдение Уэллса об устойчивости к заболеваниям и его мысль о том, что способность противостоять болезням является одним из важнейших условий адаптации, безусловно, ведут в правильном направлении. Инфекционные болезни — мощный фактор отбора, заметно повлиявший на эволюцию человека. Изучение роли инфекций также помогает объяснить закономерности распространения некоторых генетических заболеваний в некоторых популяциях. Одну из таких закономерностей смог объяснить другой врач, о вкладе которого в развитие науки упоминают незаслуженно редко.

Бактериологическая война

В 1930–1940-х годах Энтони Эллисон работал на ферме в высокогорном районе Кении, возвышающемся над Великим разломом. Еще в школьные годы Эллисон обратил внимание на большое разнообразие растений и животных, встречающихся только в определенных районах, а также на обилие местных племен и их языков. Поездка к археологу Луису Лики на раскопки в знаменитом ущелье Олдувай зародила в Эллисоне интерес к происхождению и эволюции человеческого рода. Подростком он прочел книги Дарвина «О происхождении видов» и «Происхождение человека», а позднее в Оксфордском университете познакомился с математическими выкладками Р. А. Фишера, Дж. Б. С. Холдейна и Сьюэла Райта, связавшими законы эволюции и селекции с генетикой. Пока Эллисон учился, еще не существовало доказательств влияния естественного отбора на человеческие гены. Благодаря новым научным открытиям, а также собственным способностям в самом начале своей научной карьеры Эллисон смог найти такие доказательства.

В 1949 году, оканчивая фундаментальный курс естественных наук и только начиная учиться медицине, Эллисон принял участие в экспедиции на гору Кения, организованной Оксфордским университетом. Однокурсники Эллисона больше интересовались местными растениями и насекомыми, а сам он собирал образцы крови представителей различных племен по всей территории страны для определения группы крови и других исследований.

Одной из важнейших задач было выявление случаев серповидно-клеточной анемии. Эта болезнь, открытая в 1910 г., получила свое название от серповидной формы эритроцитов в крови у больных людей (рис. 7.2).

Рис. 7.2. Нормальный и серповидный эритроциты. Аномальная форма эритроцитов объясняется нарушением структуры гемоглобина. Фотография любезно предоставлена Джеймсом Уайтом (медицинский факультет Университета Миннесоты).


Было известно, что эта болезнь имеет рецессивный характер наследования; клетки индивидов, имеющих одну копию мутированного гена (таких людей называют носителями), принимали серповидную форму лишь при определенных условиях, тогда как в крови у людей с двумя мутированными версиями гена всегда содержались аномальные эритроциты, и эти люди были больны. 1949 год стал переломным для понимания причин серповидно-клеточной анемии. Известный биохимик Лайнус Полинг и его научная группа обнаружили, что в эритроцитах больных серповидно-клеточной анемией содержится аномальный гемоглобин (белок, переносящий кислород).

В том же году во время экспедиции Эллисон обнаружил, что наличие в крови серповидных эритроцитов было весьма неравномерно распределено у представителей различных племен. Вблизи озера Виктория и на побережье Индийского океана серповидные эритроциты были обнаружены у 20 % населения. В высокогорных или засушливых районах серповидные эритроциты встречались не более чем у 1 % населения. Эллисон стал размышлять над этими наблюдениями. Почему, если серповидно-клеточная анемия является такой серьезной болезнью, аномальные эритроциты встречаются так часто? И почему представители одних племен поражены этим недугом сильнее, чем представители других?

Эллисону пришла в голову удивительная и по-настоящему блестящая идея. Он подумал, что широкое распространение серповидных эритроцитов может быть связано с устойчивостью к малярии. Эллисон знал, что малярия и переносящие ее комары гораздо чаще встречаются во влажных низинах, чем в высокогорье, где практически нет источников пресной воды.

Свою идею он смог проверить лишь через несколько лет, когда получил медицинское образование. В 1953 году он продемонстрировал, что носители гена серповидно-клеточной анемии имеют определенную устойчивость против малярии, а дети с серповидными эритроцитами имеют в крови меньше возбудителей малярии, чем дети с нормальным гемоглобином. Эллисон обследовал около 5 тыс. жителей Восточной Африки и установил, что там, где распространена малярия, до 40 % популяции могут быть носителями серповидных эритроцитов, в то время как в свободных от малярии районах уровень распространения этого признака низок. Эллисон составил карту, которая демонстрировала соответствие между распространением серповидных эритроцитов и малярии на территории Африки (рис. 7.3).

Рис. 7.3. Распространение серповидно-клеточной анемии и малярии. Карты показывают соответствие между распространением серповидных эритроцитов (справа) и малярийных комаров (слева). Рисунок Лианн Олдс на основании статьи A. C. Allison (2004), Genetics 166:1591.


Обнаруженный эффект не зависел от племенных и языковых различий и показывал, что малярия оказала глубокое воздействие на генетику человека. Эволюция гена серповидно-клеточной анемии — классический пример действия естественного отбора в человеческой популяции. Удивительно, однако, что в большинстве учебников ничего не сообщается об Эллисоне и его идее о том, что малярия была движущим фактором естественного отбора (см. список литературы).

За 50 лет, прошедших со времен пионерских исследований Эллисона, появилось много новых доказательств того, что малярия оставила в геноме человека весьма заметный след. Серповидно-клеточная анемия распространена не только в регионах к югу от Сахары, но спорадически возникает также в Греции и Индии. Шестьдесят процентов людей, живущих в районе озера Копаис в центральной части Греции, а также 32 % населения полуострова Халкидики на севере страны являются носителями гена серповидно-клеточной анемии. Тридцать процентов коренного населения региона Нилгири на юге Индии также несут в себе этот ген. Что общего между этими районами? До недавнего времени, пока не были приняты меры по борьбе с малярией, эти районы отличались высоким уровнем распространения этой инфекции.

Еще более очевидное доказательство этой связи состоит в том, что мутация, которая приводит к появлению серповидных эритроцитов и заключается в точечной замене в шестом триплете соответствующего гена (GAG меняется на GTG), возникала в человеческих популяциях не менее пяти раз: у народа банту, в Бенине, Сенегале и Камеруне, а также в Индии (рис. 7.4). Здесь на примере нашего с вами вида мы снова наблюдаем, как эволюция в точности воспроизводит сама себя.

Рис. 7.4. Мутация, приводящая к образованию серповидных эритроцитов, возникала в человеческой популяции несколько раз. На карте показаны пять регионов (Сенегал (С), Бенин (Б), Центральноафриканская республика (Ц), юг Европы и Индийский полуостров (И)), где возникала одна и та же мутация и откуда она распространилась по другим регионам. Рисунок Лианн Олдс.


В условиях жесткого давления отбора, вызванного малярийным паразитом, мутация, которая опасна для жизни, если присутствует в двух копиях гена, может сохранить жизнь, если присутствует только в одной копии гена. Именно по этой причине «плохие» копии отдельных генов могут сохраняться в популяции.

Аномальный гемоглобин из серповидных эритроцитов — не единственный пример. Фермент, который сокращенно называют G6PD[17], играет ключевую роль в метаболизме глюкозы и поддержании окислительно-восстановительного баланса внутриклеточной среды. Недостаток этого фермента — наиболее распространенный вариант ферментативной недостаточности, от которой страдают примерно 400 млн человек во всем мире. В разных человеческих популяциях обнаружены 34 различные мутации G6PD, встречающиеся с разной частотой. Хотите знать, где проживают эти популяции?

Если вы скажете, что в малярийных районах, будете совершенно правы! Невозможно представить, что распространение этих вариантов гена в малярийных районах и их отсутствие в тех районах, где малярии нет, является простым совпадением. Действительно, в организме людей с дефицитом G6PD малярийный паразит размножается слабее, чем у людей с нормальной формой фермента. Широкое эпидемиологическое исследование с участием 2000 африканских детей показало, что недостаточность G6PD снижает вероятность заболевания тяжелой формой малярии на 46–58 %. Кроме того, было показано, что в клетках с низким уровнем G6PD рост паразита заторможен. По-видимому, изменение окислительного состояния внутриклеточной среды эритроцитов с недостатком G6PD нарушает жизненный цикл паразита.

Другие мутации препятствуют развитию малярии, предотвращая проникновение паразита внутрь эритроцитов. Наиболее тяжелую форму малярии вызывает вид Plasmodium falciparum. Другой вид, P. vivax, получил преимущественное распространение в Западной Африке. Этот паразит попадает в эритроциты, связываясь с так называемым фактором Даффи на поверхности клеток. Мутация, препятствующая экспрессии белка Даффи на поверхности эритроцитов, достигает частоты 100 % в некоторых африканских популяциях, тогда как у европейцев и азиатов она встречается крайне редко. В результате этой мутации P. vivax не может проникнуть в эритроциты человека. Очевидно, что мутация гена Даффи поддерживалась естественным отбором в тех регионах, где распространена данная форма паразита.

Жесткое давление естественного отбора, связанное с распространением малярии, влияло на генетическую эволюцию человечества разными способами. Но как долго шел этот процесс? Об этом рассказывают удивительные археологические находки. Симптомы малярии описаны в древнекитайском медицинском трактате «Нэй цзин» («Трактат о внутреннем»), относящемся к 2700-м гг. до н. э. К IV веку до н. э. малярия широко распространилась в Греции, и именно с ней связывают гибель населения нескольких городов-государств. Название болезни — mala aria («плохой воздух») — придумали римляне, которые считали, что источником болезни является влажный воздух болотистой местности. Некоторые археологи считают, что малярия сыграла немалую роль в падении Древнего Рима: углубление римлян в малярийные районы подорвало ресурсы империи.

Генетический анализ позволяет ориентировочно определить время, когда малярия начала оказывать влияние на эволюцию человека. Изучая генетические маркеры, связанные с мутациями гена G6PD, Сара Тишкофф из Университета Мэриленда и ее коллеги определили, что две конкретные мутации возникли в последние тысячелетия. Кроме того, по данным ученых из Гарварда и Оксфорда, работающих над совместным проектом по изучению геномов возбудителей малярии, возбудитель наиболее тяжелой формы малярии, Plasmodium falciparum, тоже появился сравнительно недавно — от 3200 до 7700 лет назад.

Есть ли какая-либо связь между этими датами и что из них следует?

Эти события совпадают по времени с началом широкого распространения сельского хозяйства, возникшего приблизительно 10 тыс. лет назад. Они подтверждают, что малярия начала оказывать влияние на эволюцию человека сравнительно недавно. Вырубая леса и освобождая пространство для посева, люди увеличивали площади хорошо освещаемых водоемов, где размножается малярийный комар Anopheles. Рост популяции комаров, а также увеличение плотности человеческой популяции, в том числе вокруг источников воды, облегчили распространение малярии и положили начало эволюционной гонке вооружений между паразитами, комарами и людьми. В наши дни во всем мире малярией болеет около 300–500 млн человек, и 2 млн ежегодно умирают от этой болезни.

Но малярия — не единственная болезнь, распространение которой повлияло на эволюцию человека и способствовало появлению некоторых наследственных болезней. Возбудитель брюшного тифа, Salmonella typhi, сыграл роль в распространении у белокожих людей мутаций, вызывающих кистозный фиброз (КФ, или муковисцидоз). Наличие двух копий мутантного гена приводит к развитию кистозного фиброза, от которого до недавних пор люди неизбежно умирали, не достигнув 10-летнего возраста. Однако частота таких мутаций в человеческой популяции гораздо выше, чем можно было бы ожидать от мутаций, вызывающих смертельное заболевание. Лабораторные исследования показали, что бактерия S. typhi использует белок КФ для проникновения в клетки кишечника и что в клетки мышей с наиболее распространенной мутацией проникает значительно меньше бактерий S. typhi. Таким образом, эта мутация обеспечивает определенную устойчивость против возбудителя брюшного тифа. Это значит, что частые эпидемии брюшного тифа в истории человечества вполне могли привести к отбору индивидов, несущих ген кистозного фиброза.

Все патогены проникают в клетки через специфические молекулы на поверхности этих клеток, поэтому мутации этих молекул, помогающие защититься от вируса, могут играть ключевую роль в борьбе между патогенами и человеком. Выяснилось, что некоторые люди невосприимчивы к ВИЧ, поскольку имеют мутацию в гене CCR5, который кодирует часть рецептора, используемого вирусом для проникновения в клетку. Вирус ВИЧ появился слишком недавно, чтобы стать причиной частого возникновения этой мутации. Скорее всего, мутация гена ССR5 была отобрана благодаря ее способности повышать устойчивость к другому патогену. Один из кандидатов на роль такого патогена — вирус геморрагической лихорадки, весьма распространенной в Европе в Средние века.

Обман патогена путем мутации рецептора — лишь один из способов борьбы с микробами и вирусами. Если инфекция все же проникла в организм, то главной линией защиты становится наша иммунная система, у которой есть несколько возможностей для сдерживания, захвата или непосредственного уничтожения патогенов. Патогены в свою очередь выработали множество приемов, позволяющих им избежать столкновения с иммунной системой. Например, они постоянно мутируют и меняют свое обличье, чтобы всегда быть на шаг впереди нас.

В наши дни человек сделал эту гонку вооружений бесконечной, пытаясь уничтожить патогены и их источники. Для борьбы с малярией предпринимались попытки найти способы уничтожения как самого паразита (Plasmodium), так и его переносчика (Anopheles). Глобальное искоренение малярии началось в 1950-х гг. и закончилось победой в 1951 г. на юго-востоке США и в 1979 г. в Европе. Однако в других местах этот процесс, основанный на использовании ДДТ и лекарств для уничтожения комаров и паразитов соответственно, застопорился и спровоцировал новый виток эволюционной гонки вооружений, который, как это ни печально, мы проигрываем.

Например, одним из самых безопасных, дешевых, а когда-то и самых эффективных средств для борьбы с малярией был хлорохин. Однако мутация одного гена привела к тому, что плазмодий приобрел устойчивость к хлорохину. Эта устойчивость распространилась настолько широко, что препарат стал практически бесполезен. Постепенно возникла устойчивость и к таким препаратам, как мефлохин, хинин, сульфадоксин, пириметамин и другим. Точно так же попытки уничтожить комаров с помощью ДДТ привели к появлению устойчивых к этому препарату комаров (и к катастрофическим последствиям для других животных, в частности для хищников, находящихся на вершине пищевой цепи).

Ситуация критическая, но не безнадежная. На самом деле история эволюции малярии является хорошим примером того, как применение принципов эволюции в медицине (эволюционная медицина) может помочь выйти из замкнутого круга: новое лекарство — новая устойчивость, самое новое лекарство — еще более высокая устойчивость и т. д. Основная идея состоит в использовании связи между мутациями и отбором. Нам известно, что применение практически любого лекарства, действующего на конкретный белок в организме паразита, рано или поздно вызовет невосприимчивость к этому лекарству. Если лекарство применяют достаточно широко, возникают условия отбора, при которых выживают и распространяются только устойчивые к нему формы. Сначала лекарство некоторое время действует успешно, но затем болезнь возвращается вновь и существующие средства уже не могут с ней справиться.

Новый подход состоит в использовании комбинации нескольких препаратов. Идея заключается в том, что вероятность приобретения патогенным организмом устойчивости к двум или большему количеству лекарств определяется вероятностью приобретения устойчивости к каждому из них в отдельности. Допустим, один из 100 млн паразитов устойчив к действию лекарства X или лекарства Y, тогда к действию обоих лекарств окажется устойчивым один паразит из 10 тыс. трлн (100 млн х 100 млн). Другими словами, приобретение патогенным организмом устойчивости к комбинированному препарату является гораздо менее вероятным событием. Комбинированная лекарственная терапия помогает справляться с вирусом СПИДа. Новая комбинированная противомалярийная терапия, основу которой составляет активный компонент, впервые описанный в Китае во II в. до нашей эры, в сочетании с несколькими другими препаратами (возникновение устойчивости к которым является маловероятным), кажется, неплохо работает. Однако этот новый способ дороже, чем лечение хлорохином, и именно поэтому эффективные лекарства в странах Африки до сих пор малодоступны.

Современная гонка вооружений — между пестицидами и вредителями, между лекарствами и паразитами — показывает, что стремление разобраться в связи между мутациями и отбором вызвана не пустым любопытством или прихотью ученых. Это очень серьезный и важный практический вопрос. Надо надеяться, что при помощи нашего головного мозга (еще одного продукта гонки вооружений), биотехнологии (которая в соответствии с дарвиновской моделью переживает эволюционный взрыв) и знания принципов эволюционного развития мы в конце концов обуздаем, а быть может, и вовсе победим малярию. Я завершу данную главу еще одним ярким примером связи эволюции и медицины.

Внутренние враги

В качестве расплаты за то, что мы являемся крупными, сложно устроенными долгожителями, состоящими из триллионов клеток, нам приходится постоянно восполнять запасы некоторых клеток — например, клеток кожи, крови или кишечника. Для создания новых клеток необходимо копирование ДНК, и в ходе этого процесса то и дело возникают ошибки. Хотя мутации в любых клетках организма, за исключением половых клеток (сперматозоидов и яйцеклеток), не передаются следующему поколению, некоторые из них способны спровоцировать внутри нашего организма своеобразную гонку вооружений, которая сегодня чаще всего становится причиной смерти людей. Это рак.

Возникновение опухолей происходит с участием трех ключевых факторов эволюции — случайных мутаций, отбора и времени. Отправной точкой при образовании опухоли являются мутации, которые нарушают механизмы, контролирующие деление клеток и их взаимодействие с окружающими клетками и тканями. Определенные комбинации мутаций обеспечивают клеткам селективные преимущества, которые позволяют им бесконтрольно делиться. По мере роста опухоли в ее клетках появляются новые мутации, позволяющие им покидать свое местоположение, перемещаться и пролиферировать в других органах и тканях (так образуются метастазы).

Последние 30 лет биологи пытались разобраться в генетических и молекулярных механизмах возникновения рака. Одним из серьезных достижений стало открытие специфических генов, которые всегда или часто мутируют при определенных видах рака. Яркий пример — так называемая филадельфийская хромосома, связанная с возникновением хронического миелолейкоза (ХМЛ). При этом типе рака происходит расщепление и соединение хромосом, в результате чего один ген сливается с другим. Это приводит к нарушению контроля мощного регуляторного белка, называемого ABL-киназой, что способствует опухолевому перерождению клеток. Только в США ежегодно регистрируется 4400 новых случаев заболевания ХМЛ.

Долгое время лечение раковых заболеваний было неспецифическим и основывалось на применении токсичных лекарств и радиации. Эти «слепые» методы разрушают быстро делящиеся клетки, как опухолевые, так и нормальные, и имеют серьезные побочные эффекты. Однако выявление специфических повреждений ДНК при различных типах рака открыло дорогу новым методам лечения, направленным на конкретные патологически измененные молекулы, и теперь для лечения различных типов рака используется новое поколение «рациональных» химиотерапевтических препаратов.

В частности, было создано лекарство, направленно воздействующее на ABL-киназу в опухолевых клетках, которое оказалось весьма эффективным и сравнительно безопасным. Это лекарство, которое называется гливек или иматиниб, связывается с определенным участком ABL-киназы и ингибирует действие этого белка. На сегодняшний день гливек является препаратом первой линии для лечения больных с ХМЛ и во многих случаях позволяет достичь ремиссии.

Поскольку вы уже многое знаете о мутациях и отборе, вам будет несложно предсказать, что станет результатом широкого внедрения гливека в медицинскую практику: устойчивость. Гливек оказывает токсичное действие на клетки ХМЛ, и, подобно тому как подвязочная змея из Орегона вырабатывает устойчивость к TTX, а малярийный плазмодий — к противомалярийным препаратам, некоторые опухолевые клетки приобретут устойчивость к гливеку под действием дополнительных мутаций.

Чарльз Сойерс и его коллеги из Медицинского института Говарда Хьюза исследовали механизм возникновения устойчивости к гливеку у пациентов с ХМЛ. Они проанализировали состояние гена ABL-киназы у пациентов с устойчивостью к препарату и выяснили, что у них в этом гене есть дополнительные мутации. У шести пациентов была обнаружена одна и та же мутация — еще один пример воспроизведения эволюционных событий (рис. 7.5).

Рис. 7.5. Повторное возникновение мутации, обеспечивающей устойчивость к противораковому препарату. Изображен короткий фрагмент белковой последовательности (верхняя строка) и соответствующий фрагмент ДНК (вторая строка), связанные с развитием хронического миелолейкоза (ХМЛ). У шести пациентов с ХМЛ (пациенты 2, 3, 5, 7, 8 и 9) в одном и том же положении возникла мутация (звездочка), заключающаяся в замене основания C на T, в результате которой опухолевые клетки стали нечувствительными к лекарству, связывающемуся с данным белком. Рисунок выполнен Лианн Олдс на основании данных из статьи Gorre et al. (2001), Science 293:876.


Замена в гене ABL-киназы основания C на T приводила к замене треонина на изолейцин. Поскольку нам известен механизм взаимодействия гливека с ABL-киназой, мы понимаем, что эта замена изменяет структуру кармана в молекуле белка, в который должен проникать гливек, поэтому препарат больше не связывается с белком и не блокирует его функцию. Если сначала гливек контролировал рост опухолевых клеток и уничтожал их, теперь клетки с такой точечной мутацией способны уходить от действия препарата, и болезнь может возобновляться.

Это, конечно же, плохая новость. Но первое сражение — это еще не вся война.

Теперь, зная о том, что у некоторой части пациентов вырабатывается устойчивость к гливеку, а также о том, что некоторые из мутаций, обеспечивающих клеткам устойчивость, возникают в одном и том же месте, исследователи занялись синтезом новых препаратов. Например, Сойерс и его соавторы из фармацевтической компании Bristol-Myers Squibb создали другой ингибитор ABL-киназы (временное название — BMS-354825), который проявляет активность против 14 из 15 устойчивых к гливеку киназ. Это открытие вселяет надежду на то, что пациентам, которым не помог гливек, смогут подобрать эффективный препарат второй терапевтической линии. Это открытие также создает условия для дополнительной стратегии — комбинированной терапии. Как в случае малярии или ВИЧ, понимание связи между мутациями, отбором и эволюцией помогает выработать новый рациональный план борьбы с одной из форм рака.

Детальное изучение генетических особенностей пациентов с ХМЛ позволило обнаружить в раковых клетках мутации, способствующие устойчивости к гливеку, еще до применения гливека. Это ключевой момент. Сами лекарства или токсины не вызывают устойчивости; вспомним, что мутации возникают случайным образом. Роль лекарств состоит в создании селективных условий, при которых способны выжить только обладающие устойчивостью паразиты, бактерии, вирусы или, как в нашем случае, опухолевые клетки. По мере разрастания опухоли в результате постоянного накопления мутаций опухолевые клетки становятся все более разнородными. Определенная популяция клеток (если опухоль достаточно большая) случайно может стать устойчивой к лекарственному препарату. Поэтому сейчас ведутся исследования с использованием двух (а в дальнейшем, возможно, и трех) ABL-специфичных препаратов, которые могли бы полностью уничтожить болезнь до появления лекарственной устойчивости. Наилучшая стратегия, безусловно, заключается в том, чтобы нанести удар как можно раньше и как можно сильнее.

Уроки гливека сегодня помогают находить пути лечения многих типов рака. И это дает надежду, что при лечении рака мы научимся лучше учитывать генетические особенности пациентов, предупреждать развитие устойчивости к препаратам и, следовательно, добьемся больших успехов.

Естественный отбор: абсолютная необходимость

Я начал эту книгу с рассказа об удивительных ледяных рыбах, для которых необходимость снизить вязкость крови в холодной воде перевесила нужду в эритроцитах и гемоглобине. А в этой главе мы увидели, как то же самое происходит у людей: необходимость победить малярию, вызванную к жизни нашей же культурной эволюцией, ускорила модификацию нашего гемоглобина и других белков эритроцитов.

Эволюция ледяных рыб и людей показывает, что естественный отбор работает с тем исходным материалом, который есть в наличии. Возможно, решения, принятые природой для защиты организмов от малярии или холодной воды, были не самыми рациональными, но они были лучшими из доступных решений. В определенных условиях действие естественного отбора благоприятствует распространению таких «плохих» мутаций, как мутации в серповидных эритроцитах или мутации гена G6PD, а также необратимому превращению некоторых генов в ископаемые гены. И в каждом случае речь идет о том, что немедленные преимущества перевешивают немедленные потери, пусть даже совсем ненамного.

Эти примеры замечательны тем, что они переворачивают наши представления о «прогрессе» и «планировании» в формировании организмов. Создание самых приспособленных — это импровизация, а не реализация заготовленного сценария. Природа работала над этим непрерывно на протяжении трех с лишним миллиардов лет.

В пяти последних главах я привел некоторые из самых ярких свидетельств эволюции путем естественного отбора на самом фундаментальном уровне, то есть на уровне ДНК. В данной главе я выбрал такие примеры, которые позволяют увидеть, что процесс отбора происходит повсеместно. Где бы ни происходили изменения — у тритонов или змей, у паразитов, комаров или человека или в делящихся опухолевых клетках, — возникающее соревнование между хищником и жертвой, патогеном и хозяином или устойчивыми и чувствительными к лекарству клетками приводит к изменениям генофонда популяции. В этом и состоит суть эволюции.

Нет никаких сомнений в том, что естественный отбор может действовать на уровне мельчайших различий между особями: небольшие изменения в бессмертных генах на протяжении 3 млрд лет удалялись из геномов миллиардов видов, а единственная замена в гене гемоглобина позволила представителям нашего вида противостоять малярии. Однако до сих пор я ничего не сказал еще об одном аспекте долгосрочного влияния естественного отбора — о его кумулятивной (накопительной) способности к созиданию. Могли естественный отбор незначительных вариаций внести реальный вклад в формирование столь глубоких различий по степени сложности, какие мы наблюдаем у живых организмов?

За ответом на этот вопрос мы вновь обратимся к летописи ДНК и посвятим этой теме следующую главу.

Большой Барьерный риф Австралии создан и заселен многими видами животных. Фотография Антонии Валентин.

Глава 8 Создание и эволюция сложного

Простоту природы нельзя измерить нашими мерками. Бесконечно разнообразная природа проста лишь в своих мотивах, а ее суть состоит в создании огромного числа явлений, часто очень сложных, с помощью небольшого набора общих законов.

Пьер Симон Лаплас. «Изложение системы мира» (1796)

Хотя через трубку поступает достаточно кислорода, дух все равно захватывает.

Пышная процессия животных кораллового рифа, дрейфующая над желтым, пурпурным и бурым лесом кораллов являет собой настоящее буйство цветов, форм и размеров: косяки неоновых рыб, великолепные морские звезды, пятнистые осьминоги, колючие морские ежи, зеленые водяные черепахи, черноперые акулы, гигантские кальмары с бирюзовыми или пурпурными мантиями, полосатые крабы, пятнистые скаты и кремовые анемоны.

Большой барьерный риф Австралии, без сомнения, является одним из величайших чудес природы. Он простирается почти на 2 тыс. км вдоль восточного берега континента и представляет собой самую крупную на Земле структуру, созданную живыми организмами и единственную видимую с Луны.

Это великое чудо природы приводило в изумление многих великих натуралистов, которые задавались вопросом: откуда оно взялось? Как возникло такое невероятное разнообразие форм жизни?

В начале XIX в., когда геология стала бурно развиваться и искать естественные объяснения происхождения различных типов ландшафтов, все в основном сходились на том, что коралловые рифы возникают на вершинах кратеров подводных вулканов. Казалось, подобный механизм вполне логично объяснял возникновение округлых коралловых островов в южной части Тихого океана, окружающих лагуны с кристальной голубой водой. Однако в геологии и, как мы вскоре увидим, в биологии внешние проявления могут оказаться обманчивыми. Идея о вулканическом происхождении коралловых рифов была опровергнута. Догадайтесь кем.

Если вы скажете, что Дарвином, будете совершенно правы.

За 20 лет до выхода книги «О происхождении видов» в двух своих трудах (сначала в «Журнале исследований по геологии и естественной истории различных стран, посещенных в ходе кругосветного путешествия на Бигле», более известном как «Путешествие на Бигле» (1839), а затем в более развернутом виде в «Структуре и распределении коралловых рифов» (1842)) Дарвин дал новое объяснение образования всех типов коралловых рифов, включая Большой Барьерный риф. У его теории по меньшей мере два важных аспекта. Во-первых, она верная. Идею Дарвина не принимали и опровергали на протяжении многих десятилетий, но в конечном итоге он (снова!) оказался прав. Во-вторых, смелость Дарвина, его умение теоретически рассуждать о длительных процессах, которых никто не мог увидеть своими глазами, и способность делать общие выводы на основании отдельных наблюдений стали основой его подхода к возникновению всего живого.

Дарвин отверг вулканическую теорию происхождения коралловых рифов, так как сомневался в возможности существования кратеров столь большого диаметра, чтобы они могли охватить некоторые крупные атоллы, а также в том, что под водой могло возникнуть такое скопление больших вулканических кратеров, на месте которых появились протяженные цепи атоллов. Дарвин также указал на то, что вулканическая теория слишком атоллоцентрична и не объясняет происхождение двух других форм — окаймляющих рифов, окружающих океанические острова, и барьерных рифов, окружающих острова с лагунами. Дарвин предположил, что все три варианта рифов являются последовательными стадиями одного и того же процесса (рис. 8.1).

Рис. 8.1. Образование кораллового рифа. Дарвин предположил, что три основные формы рифов являются последовательными стадиями одного и того же процесса. Сначала вокруг острова возникает окаймляющий риф; по мере оседания суши он превращается в барьерный риф, окружающий остров вместе с лагуной. В конечном итоге поверхность суши погружается под воду, и риф превращается в окружающий лагуну атолл. Рисунок Лианн Олдс.


В соответствии с идеей Дарвина сначала вдоль берегов нового острова возникает окаймляющий риф. Затем, по мере того как остров оседает, риф продолжает расти, превращаясь в барьерный риф и образуя лагуну вокруг острова. И наконец, когда остров скрывается под поверхностью океана, возникает атолл.

Рост большинства кораллов и погружение островов нельзя увидеть глазами: крупные кораллы растут не более чем на 5 мм в год. Однако Дарвин сумел оценить кумулятивный эффект постепенных изменений, происходящих за длительный период времени, что позволило ему выстроить свою теорию. А через 20 лет после возникновения этой теории он по-новому объяснил происхождение невероятного разнообразия обитающих здесь видов.

Геологическая и биологическая теории Дарвина основаны на широкой экстраполяции — от едва заметных постепенных изменений до крупных превращений, от настоящего в прошлое и от простых форм к более сложным. В значительной степени несогласие с теорией Дарвина связанно именно с сомнениями в обоснованности подобных экстраполяций (в частности, с неприятием идеи «сложения» эффектов на протяжении длительного отрезка времени). Я в своей книге тоже нередко прибегаю к экстраполяциям. Например, я рассказывал о том, что незначительные изменения зрительных пигментов позволяют организмам адаптироваться к изменению освещенности в их среде обитания. Я надеюсь, что после прочтения предыдущих пяти глав у вас не осталось сомнений относительно реальности естественного отбора. В этом и состоит главная задача этой книги — устранить все сомнения. Но вы, возможно, все еще захотите мне возразить: допустим, все это верно в отношении небольших изменений уже существующих сложных структур, но как и из чего этот самый глаз впервые возник?

Это нужный и важный вопрос.

Эволюция сложных структур долгое время была в центре внимания биологов и оставалась прибежищем противников эволюции. Довольно часто случается, что люди признают вариабельность и эволюцию внутри существующих видов (то есть «микроэволюцию»), но отказываются экстраполировать этот процесс на происхождение новых видов и эволюцию сложных признаков, выходящих за пределы вариаций внутри вида («макроэволюция»). В некоторых штатах США дело доходит до того, что в учебниках по биологии заклеивают соответствующие страницы (см. главу 9).

Чтобы объяснить, каким образом естественный отбор создает органы «чрезвычайного совершенства и сложности», Дарвину пришлось оперировать очень большими временными интервалами. Объяснение Дарвина было блестящим, но оно основывалось на экстраполяции от простого к сложному, а не на эмпирических знаниях об истории формирования глаза. Подробности образования и эволюции таких сложных структур в то время не были известны и продолжали оставаться тайной на протяжении большей части следующего столетия.

Но сегодня ситуация изменилась.

За последние 20 лет были получены прямые доказательства того, как возникли и развивались сложные структуры, в частности в организме животных. Это новое понимание появилось в основном благодаря успехам биологии развития, науки, которая изучает процесс превращения единственной клетки (яйца) в сложный организм, состоящий из миллиардов или триллионов клеток. Развитие организма теснейшим образом связано с эволюцией формы, поскольку все вариации и изменения формы сопровождаются изменением развития. Исследования в области эволюционной биологии развития (сокращенно эво-дево, от англ. evolution of development) привели ко многим неожиданным и важным открытиям, касающимся эволюции сложных организмов и их частей, и эти открытия лишают противников эволюции последних аргументов[18].

В этой главе я расскажу о некоторых наиболее важных открытиях в области эволюционной биологии развития, относящихся к эволюции сложных структур у животных. Я объясню, каким образом понимание процесса развития позволяет установить происхождение сложных структур, а сравнение путей развития разных организмов помогает понять эволюцию сложных признаков. Я сконцентрируюсь на описании особой группы генов, ответственных за построение тела и органов, а также на той части заключенной в ДНК информации, о которой я пока еще не рассказывал, но которая играет ключевую роль в понимании эволюции формы.

Внешность обманчива: у всех животных один и тот же набор генов для построения тела и органов

Животные, которых я увидел на Большом барьерном рифе, были представителями многих ветвей эволюционного древа. Из 35 основных групп, или типов, животных здесь встречаются кишечнополостные (кораллы, морские анемоны), губки, моллюски (кальмары, осьминоги), членистоногие (крабы), иглокожие (морские звезды и ежи), а также позвоночные (акулы, костные рыбы, морские черепахи и киты). Многие из этих животных характеризуются какими-то уникальными особенностями (панцири черепах, щупальца осьминогов, раковины моллюсков, клешни крабов и т. д.), однако у всех есть органы, необходимые для одних и тех же целей, например, глаза.

Нет сомнений в том, что глаза приносят пользу своим владельцам. Однако многих биологов со времен Дарвина удивляло разнообразие устройства глаз в царстве животных. Человек и другие позвоночные обладают глазами камерного типа с единственным хрусталиком. Крабы и другие членистоногие имеют сложные (фасеточные) глаза, в которых зрительную информацию независимым образом собирает множество отдельных зрительных ячеек. Осьминоги и кальмары, хотя и не являются нашими родственниками, тоже имеют камерные глаза, а вот у их более близких родственников, двустворчатых моллюсков, глаза бывают трех типов: камерные глаза с единственным хрусталиком, зеркальные глаза с хрусталиком и отражателем, а также сложные глаза, составленные из 10–80 ячеек.

На протяжении 100 с лишним лет ученые считали, что большое разнообразие строения глаз является результатом независимых «изобретений», произошедших в разных группах. На основании клеточного строения глаз животных знаменитый биолог-эволюционист Эрнст Майр и его коллега Л. В. Сальвини-Плевен предположили, что глаза в ходе эволюции возникали независимым образом от 40 до 65 раз.

С одной стороны, это утверждение поддерживает теорию о воспроизведении эволюционных событий при возникновении одних и тех же потребностей (в данном случае речь идет о потребности видеть). Идея о повторении эволюции глаз была широко распространена. Однако новые открытия заставили ученых пересмотреть свой взгляд на эволюцию глаза. Основной вопрос заключается в следующем: возникли ли глаза «из ничего» или их эволюция строилась на готовых элементах, имевшихся у одного или нескольких общих предшественников. Именно от этого зависят наши представления о вероятности эволюции сложных структур. Конечно, кажется более «трудным делом» (менее частым или менее вероятным) создание какой-либо структуры на пустом месте, из ничего, по сравнению с ситуацией, когда части этой структуры уже существуют. Новые данные показывают, что совершенно разные глаза, имеющиеся у разных типов животных, имеют между собой гораздо больше общего, чем кажется на первый взгляд, и эта общность позволяет нам лучше понять процесс эволюции сложных структур.

История формирования нового взгляда на эволюцию глаза началась в 1994 г. Вальтер Геринг и его коллеги из Университета Базеля (Швейцария) занимались изучением гена, необходимого для развития сложного глаза у дрозофилы. Когда этот ген инактивировали с помощью мутаций, глаз не формировался. Еще раньше ученые, занимающиеся генетикой дрозофил, прозвали этот ген безглазым (eyeless) (многие гены получают свое название от той функции, которая нарушается в случае их мутации; на самом деле нормальная функция данного гена состоит в содействии формированию глаза). Когда ученые выделили ген eyeless, они, к своему большому удивлению, обнаружили, что он кодирует белок, который чрезвычайно сильно напоминает белки, кодируемые мышиным и человеческим генами. Мышиный белок назвали маленьким глазом (Small eye); он также необходим для формирования глаза. Человеческий белок получил имя аниридия (Aniridia), поскольку его дефект приводит к исчезновению радужной оболочки глаза. Сходство между белками человека, мыши и дрозофилы настолько велико, что становится ясно — это один и тот же белок у разных видов организмов (рис. 8.2).

Рис. 8.2. Фрагмент белковой последовательности, кодируемой геном Pax-6. Здесь представлены фрагменты белка дрозофилы, мыши и человека. Обратите внимание на большое сходство между белками дрозофилы и млекопитающих, а также на идентичность последовательностей белка мыши и человека.


Теперь этот белок носит общее и менее выразительное имя — Pax-6.

Открытие гена Pax-6 тут же вызвало новый вопрос: является ли наличие одинаковых генов у животных со столь разными глазами, как у насекомых и млекопитающих, простым совпадением или имеет какой-то глубокий смысл? Другими словами, использовали ли дрозофилы и млекопитающие ген Pax-6 для независимой эволюции своих глаз «из ничего» или кажущиеся столь разными глаза имеют между собой больше общего, чем представляется на первый взгляд, и их формирование при участии гена Pax-6 является отражением какого-то фундаментального принципа?

Теперь появилось множество новых данных, позволяющих ответить на этот вопрос. Сначала экспериментальным путем было показано, что гены Pax-6 мыши и дрозофилы являются взаимозаменяемыми. Швейцарские ученые активировали ген Pax-6 дрозофилы в необычных местах, таких как ноги, крылья или усики, и обнаружили, что это приводит к формированию тканей глаза! Затем они установили, что мышиный ген Pax-6 может индуцировать образование глазной ткани у дрозофил. Таким образом, эти гены имеют одинаковые функции, а не только очень похожие последовательности. Вспомните, в третьей главе мы говорили о том, что никакой ген не может сохраняться во времени без поддержки со стороны естественного отбора. По какой-то причине функция и последовательность белка Pax-6 сохранялась на протяжении длительного периода эволюции животных — более 500 млн лет.

Причина сохранности гена Pax-6 стала ясна в результате серии экспериментов, посвященных исследованию роли этого гена в образовании глаз у других животных. Изучение гена Pax-6 кальмаров и различных червей, таких как планарии и ленточные черви, показало, что ген также участвует в формировании сложных или простых глаз у этих животных.

Поскольку Pax-6 задействован в развитии глаз у столь широкого круга организмов, очень маловероятно, что все они стали использовать этот ген случайно. Участие гена Pax-6 в развитии глаза должно иметь исторические причины. Это означает, что общий предшественник всех этих животных использовал Pax-6 для создания каких-то, возможно очень примитивных, глаз. И все удивительные и сложные глаза, развившиеся у потомков этого общего предка, эволюционировали именно на этом основании.

Следующий вопрос, на который необходимо ответить, если мы хотим воссоздать картину эволюции сложных органов, заключается в том, что же это было за основание. Какие элементы, в дальнейшем использовавшиеся для эволюции более сложных глаз, уже существовали у общего предка животных?

Об этих элементах нам известно достаточно много. Глаза любого типа состоят из регистрирующих свет клеток, называемых фоторецепторными клетками, и пигментных клеток, определяющих угол падения света на фоторецепторные клетки. Таким образом, резонно предположить, что самые примитивные глаза состояли из этих двух типов клеток. Именно такое предположение и сделал Дарвин: «Самый простой орган, который можно было бы назвать глазом, состоит из зрительного нерва, окруженного пигментными клетками и покрытого прозрачной кожей, но без хрусталика или преломляющего тела».

Такие простые двухклеточные глаза действительно существуют. Они были обнаружены у личинок некоторых существ, таких как морские черви нереиды (Platynereis dumerilii). На второй день развития оплодотворенной яйцеклетки личинка имеет пару двухклеточных глаз, «пристально глядящих» с передней стороны туловища (рис. 8.3, верхний ряд).

Рис. 8.3. Простые и более сложные глаза у морских червей. На второй день развития у личинки нереиды (вверху слева) уже существует пара простых глаз, каждый из которых состоит всего из двух клеток (вверху справа). У взрослого червя образуются две пары глаз (внизу слева), состоящих из гораздо большего числа клеток, организованных в форме чаши (внизу справа). В формировании обоих типов глаз задействованы одинаковые гены. Верхние рисунки, а также нижний правый рисунок любезно предоставлены Детлевом Арендтом из Европейской молекулярно-биологической лаборатории в Гейдельберге (из статьи Arendt et al., 2002, Development 129:1143, с изм.); нижний левый рисунок предоставлен Бенжамином Прюдоммом из Медицинского института Говарда Хьюза и Университета Висконсина.


Но простота строения этих глаз обманчива. Они построены из тех же компонентов, что и более сложные и совершенные глаза. Например, регистрация света фоторецепторными клетками этих простых глаз основана на действии опсинов — тех самых зрительных пигментов, о которых мы говорили в предыдущих главах. Все животные используют опсины для регистрации света. Объяснить этот факт можно единственным образом: опсин существовал уже в примитивных глазах общего предшественника большинства животных и с тех пор используется для детекции света во всех типах глаз.

Картину формирования и эволюции более сложных глаз исследовали на примере тех же личинок нереиды. Рядом с двухклеточными глазами личинки в какой-то момент начинают формироваться более крупные глаза взрослой особи, имеющие форму чаши и состоящие из гораздо большего числа фоторецепторных и пигментных клеток (рис. 8.3, нижний ряд). Сложность в данном случае является результатом организации большего количества таких же клеток в трехмерном пространстве — тот же строительный материал, другая конструкция. А для строительства используются те же инструменты. В этом процессе участвует ген Pax-6 и еще как минимум два других гена, таких же как у дрозофил и позвоночных. Создание более крупного, но все еще примитивного глаза взрослого червя из тех же основных типов клеток, а также использование тех же генов, что служат для построения более сложных фасеточных и камерных глаз, демонстрирует нам путь создания и эволюции сложных органов. Анализируя этот процесс, мы видим, что сложные органы строятся путем сборки большого количества клеток всего нескольких типов и что в ходе эволюции для построения глаз современных животных продолжали использоваться те же типы клеток и те же гены. Для создания глаз с различным строением у разных животных применяются те же «строительные кирпичики» и те же «инструменты».

С учетом этих новых представлений получается, что разные типы глаз являются продуктом разных эволюционных путей, начавшихся со сходных стартовых позиций, с некоей простой конфигурацией фоторецепторных и пигментных клеток, но не с пустого места. Также неверно, что камерный глаз эволюционировал из фасеточного глаза или наоборот. Представьте себе современные сложные типы глаз и попытайтесь превратить один тип в другой. Это невозможно сделать без потери эффективности органа у промежуточных вариантов. Но в ходе эволюции этого и не происходило.

Напротив, сегодня нам представляется, что история эволюции глаза состояла в повторяющемся акте построения более сложного органа из более простых «протоглаз» (рис. 8.4).

Рис. 8.4. Происхождение и эволюция сложного глаза. Под контролем гена Pax-6 у общих предшественников животных возникли фоторецепторные клетки, способные детектировать свет с помощью белков-опсинов. Сложные глаза эволюционировали из более простой структуры, состоявшей из фоторецепторных и пигментных клеток. Общий предшественник билатеральных животных имел два типа фоторецепторных клеток: рабдомерные фоторецепторы в протоглазах отвечали за зрение, а цилиарные фоторецепторы в головном мозге — за регуляцию суточного ритма. Рабдомерные рецепторы стали основой эволюции глаз членистоногих и головоногих животных, а в эволюции глаз позвоночных животных были задействованы оба типа рецепторов. Рисунок Лианн Олдс.


Роль естественного отбора в эволюции сложных глаз с лучшими оптическими характеристиками объяснить несложно. Начиная с простой структуры, постепенно накапливались небольшие изменения, улучшавшие функциональные характеристики органа. Если мы рассмотрим лишь одну ветвь на филогенетическом древе животных, например ветвь моллюсков, то обнаружим большое разнообразие глаз с разной степенью сложности (рис. 8.5).

Рис. 8.5. Различные стадии эволюции глаза у моллюсков. Моллюски имеют глаза различного строения; это могут быть простые пигментированные глазки (а), глаза в форме чаши (б), глаза, заполненные клеточной жидкостью (в), глаза с наружной линзой (г) и сложные глаза (как у кальмара) (д). Из книги M. W. Strickberger, Evolution, © 1990 by Jones and Bartlett Publishers, Boston.


С помощью компьютерного моделирования Дан Нильсон и Сюзанна Пелгер из Университета Лунда (Швеция) показали, что отбор малых вариаций за 2 тыс. стадий на протяжении 500 тыс. лет мог привести к образованию камерного глаза из простого прототипа.

Детализация картины эволюции глаза помогла объяснить некоторые интересные различия между разными типами глаз. Например, в глазу человека фоторецепторы повернуты от света и находятся на задней стенке глазного яблока, тогда как у кальмара они направлены к свету и располагаются спереди (см. рис. 8.4).

Чрезвычайно сложно (и не нужно) пытаться представить себе, каким образом один тип строения перешел в другой. Очевидно, что для эволюции глаз камерного типа существовало несколько путей, и головоногие и позвоночные пошли разными путями.

Еще одним важным отличием глаз человека от глаз кальмара или дрозофилы является тип фоторецепторов: у человека и других позвоночных фоторецепторные клетки (палочки и колбочки) относятся к так называемому цилиарному типу, тогда как фоторецепторы кальмаров и дрозофил относятся к рабдомерному типу. Различие состоит в том, каким образом мембраны рецепторных клеток каждого типа расширяются для соединения с опсинами. Этот признак служил важным аргументом в пользу независимого происхождения глаз позвоночных и других животных.

Новые открытия, сделанные все на тех же незамысловатых нереидах, прояснили тайну происхождения наших глаз и фоторецепторов. Детлев Арендт и его коллеги из Европейской молекулярно-биологической лаборатории в Гейдельберге (Германия) обнаружили в развивающемся головном мозге нереид несколько цилиарных (реснитчатых) клеток, которые странным образом напоминали фоторецепторные клетки позвоночных. Дальнейшие исследования показали, что эти клетки синтезируют некий опсин, который больше похож на опсины позвоночных, чем на опсины, обнаруженные в фоторецепторных клетках в глазах самих нереид или других беспозвоночных животных. Опсин цилиарных клеток головного мозга (c-опсин), как выяснилось, нужен не для зрения, а для регуляции суточного ритма. Таким образом, оказалось, что кольчатые черви нереиды имеют оба типа фоторецепторов и опсинов. Это означает, что общий предшественник нереид, кальмаров и позвоночных также имел все эти типы фоторецепторов и опсинов. Рабдомерные фоторецепторы и их опсин (r-опсин) послужили для создания зрительной системы у членистоногих и головоногих организмов, тогда как для создания зрительной системы у позвоночных природа использовала цилиарные фоторецепторы и c-опсин. Кроме того, рабдомерные рецепторные клетки в глазах позвоночных превратились в так называемые ганглиозные клетки сетчатки, функция которых состоит в передаче сигнала в головной мозг. Таким образом, глаза позвоночных животных, по-видимому, сформировались из обоих типов фоторецепторных клеток.

Глаз, таким образом, не только перестал быть примером органа, которому трудно дать эволюционное объяснение, но и служит для нас одним из важнейших источников информации о том, как эволюция создает сложные структуры с помощью общих генетических инструментов. Открытия в области биологии развития показали, что для создания совершенно разных по строению сердец, пищеварительных систем, мышц, нервов и конечностей у всех видов животных используются одни и те же генетические инструменты. Совершенно очевидно, что подобно фоторецепторам, которые представляют собой древний тип клеток, другие типы клеток, из которых состоят многие ткани и органы, также имеют древнее происхождение. Более того, в результате анализа генов и геномов стало известно, что большинство животных снабжены сходными наборами инструментов (генов) для построения тела и органов (ветвь позвоночных имеет более широкий ассортимент этих генов в результате масштабных процессов удвоения генов). Все это говорит о том, что сам этот набор инструментов также имеет древнее происхождение и должен был существовать у общего предшественника еще до начала эволюции тел и органов большинства современных животных.

Мы не знаем, кто был этим общим предком. Но если попытаться изобразить это существо, то нужно представить себе небольшое свободно плавающее морское животное с мягким телом, напоминающее личинку нереиды (см. рис. 8.3, слева вверху), с полным генетическим «набором инструментов развития», множеством типов клеток и простыми органами. Такое животное является хорошей аппроксимацией того существа, которое послужило основой эволюции всего царства животных.

Эти новые открытия позволяют нам проследить за процессом возникновения и эволюции сложных структур. Но при этом возникает новый парадокс: почему при такой общности клеточных типов и генов возникло такое большое разнообразие форм?

Биоразнообразие — результат использования одинаковых генов разными способами

Прежде чем я продолжу рассказ об эволюции формы, необходимо подчеркнуть принципиальное различие между белком Pax-6 и другими белками из эволюционного инструментария с одной стороны и различными типами белков, о которых я говорил в предыдущих главах, с другой. Опсины, глобины, рибонуклеазы, обонятельные рецепторы и другие белки непосредственным образом отвечают за физиологические функции — зрение, дыхание, расщепление пищи или обоняние. А Pax-6 и другие белки из «набора инструментов» необходимы для создания формы — они контролируют количество, размер и форму частей тела, а также типы клеток, участвующих в построении тела. Большинство белков этой группы прямо или косвенно воздействуют на то, где и когда самые разные гены используются в организме. Столь значительная роль гена Pax-6 (потеря глаз при его инактивации и появление глаз при его активации) связана с его влиянием на многие другие гены на разных стадиях развития. Более того, Pax-6 и большинство других генов этой группы выполняют при формировании тела и его частей не одну, а несколько обязанностей. Например, Pax-6 участвует также в построении головного мозга и носа млекопитающих. Некоторые гены из этого «набора инструментов» задействованы в формировании десяти, двадцати и большего количества различных частей тела.

По этой причине чрезвычайно важное различие между генами, связанными с физиологической функцией, и теми, что участвуют в формировании тела, заключается в последствиях мутаций этих генов. Мутации гена опсина могут вызвать изменение диапазона спектра, детектируемого палочками или колбочками глаза. А вот мутация гена, ответственного за формирование тела, может привести к полной потере глаза или какого-то другого органа. По этой причине мутации генов из «набора инструментов» часто вызывают катастрофические последствия и не могут сохраняться в геноме. В результате эволюция формы чаще происходит путем изменения способа применения генов из «набора инструментов», чем изменения самих этих генов.

Я приведу два примера, показывающих, что эволюция формы часто происходит в результате изменений тех участков ДНК, которые не кодируют белки, но содержат инструкции для использования инструментальных (регуляторных) генов. Именно в этих менее изученных последовательностях ДНК содержатся ключи к пониманию того, каким образом столь богатое архитектурное разнообразие смогло возникнуть при использовании одного набора инструментов.

Одной из очевидных отличительных особенностей крупных и сложных животных является то, что их тело построено из повторяющихся фрагментов. Как ткани и органы строятся из клеток-кирпичиков, так и тела животных в целом часто тоже составлены из отдельных кирпичиков. Например, сегменты — кирпичики тела членистоногих (насекомых, пауков, ракообразных, многоножек), а позвонки — кирпичики позвоночника человека и других позвоночных животных. Многие структуры, связанные с этими кирпичиками тела, также повторяются: ноги, когти, крылья, усики и т. д. у членистоногих и ребра и конечности у позвоночных. Одна широко распространенная тенденция в эволюции тела животных заключается в изменении количества и типа повторяющихся частей. Основным признаком, на основании которого выделяют отдельные классы членистоногих, является количество сегментов и количество и вид конечностей. Аналогичным образом классы позвоночных различаются по количеству и типу (шейные, грудные, поясничные, крестцовые) позвонков.

Различие в числе и форме повторяющихся элементов наблюдается не только между таксономическими группами, но встречается и среди представителей родственных видов или популяций. Например, во многих озерах Северной Америки водится трехиглая колюшка двух типов: в придонной части мелких водоемов живет колюшка с редуцированными шипами, а в открытой, глубокой воде — колюшка с хорошо развитыми шипами (рис. 8.6).

Рис. 8.6. Эволюция брюшного плавника у трехиглой колюшки. Во многих озерах обнаружены две формы трехиглой колюшки. В популяции придонных рыб скелет брюшного плавника недоразвит. Это изменение скелета связано с изменением функции генетического переключателя, контролирующего участие гена Pitxi в развитии брюшного плавника (X). Рисунок Лианн Олдс.


Брюшной шип является частью брюшного плавника, а брюшные и грудные плавники — это повторяющиеся структуры. Размер брюшного шипа находится под влиянием естественного отбора, поскольку он защищает колюшку от хищников. В открытых водоемах длинный шип защищает рыб от более крупных хищных рыб, а вот на дне озера он становится обузой, поскольку личинки стрекоз поедают молодых колюшек, хватая их за шипы.

Эволюция этих двух разновидностей колюшек имеет совсем недолгую историю. Озера, в которых они живут, образовались в результате таяния льдов в конце последнего ледникового периода, примерно 10 тыс. лет назад. Озера были заселены океанской колюшкой, которая несколько раз давала начало популяциям с длинными и с короткими шипами. Исключительно подробная ископаемая летопись подтверждает быструю эволюцию этих рыб.

Поскольку две популяции эволюционировали лишь недавно, их представители по-прежнему могут спариваться и давать потомство. Это позволяет генетикам обнаружить генетические изменения, лежащие в основе изменения формы тела. Недавно Дэвиду Кингсли, Дольфу Шлатеру и их коллегам из Университета Стэнфорда и Университета Британской Колумбии удалось идентифицировать гены, ответственные за эволюцию отдельных признаков у колюшки. Эволюция одного признака, длины брюшного шипа, демонстрирует, каким образом формирование повторяющихся структур зависит от способа использования регуляторных генов.

Уменьшение размера брюшного шипа у придонной популяции колюшки вызвано нарушением развития зачатка плавника. Недавно был идентифицирован ответственный за эти изменения ген, оказавшийся одним из генов «набора инструментов», известным под названием Pitxi. Это типичный «инструментальный» ген: в процессе развития рыб он выполняет несколько функций, контролирует другие гены и имеется также у других животных. Например, у мышей Pitxi отвечает за отличия задних конечностей от передних (конечности — это еще одна повторяющаяся структура).

Анализ окаменелостей показывает, что брюшной плавник был эволюционным предшественником задних конечностей четвероногих животных. Участие Pitxi в развитии брюшного плавника у рыб и задних конечностей у млекопитающих является прекрасным независимым подтверждением этого факта.

Но я хочу обратить ваше внимание на то, что брюшной плавник рыб редуцировался в результате изменения гена Pitxi, а в других частях тела, в формировании которых участвует Pitxi, изменений не произошло.

Чтобы понять, как это могло случиться, следует сравнить белки Pitxi у рыб с длинным и коротким брюшным шипом. Последовательности этих белков абсолютно одинаковы.

Но разве я не утверждал, что различия в строении брюшного плавника связаны с геном Pitxi? Да, утверждал. Этот кажущийся парадокс разрешается, если учесть, что кроме кодирующей последовательности каждый ген имеет некодирующую последовательность ДНК, выполняющую регуляторную функцию. Регуляторные последовательности, содержат элементы, работающие наподобие переключателей, которые определяют, где и когда будет или не будет использоваться соответствующий ген. «Инструментальные» гены могут иметь несколько отдельных переключателей, каждый из которых определяет работу гена в той или иной части тела. Функционирование этих переключателей определяется последовательностью их ДНК, и изменения в этой последовательности могут влиять на работу генов. Важной особенностью переключателей является то, что изменение в одном из них не влияет на функцию других. И именно это проливает свет на эволюцию формы тела и органов. Получается, что функция «инструментального» гена может изменяться в одном органе или структуре без изменения его функции в других структурах.

Действительно, у колюшки с укороченным брюшным шипом ген Pitxi не участвует в развитии брюшного плавника. Изменения в структуре переключателя, регулирующего его действие в задних конечностях, привели к специфическому изменению этой части скелета (рис. 8.6). Этот пример показывает, каким образом изменения на уровне ДНК могут способствовать быстрой эволюции анатомических признаков.

Редукция задних конечностей происходила в эволюции позвоночных несколько раз. У китообразных и ламантинов задние конечности в значительной степени редуцировались по мере превращения сухопутных предшественников этих животных в морских обитателей. Уменьшение размеров конечностей или их полное исчезновение произошло также у змей и безногих ящериц. Пример трехиглой колюшки и многие другие, которых я не привожу в этой книге, показывают, каким образом происходили подобные изменения формы тела и органов.

Уменьшение размеров органов и их исчезновение — это лишь одна сторона эволюции формы. Конечно, нам хотелось бы узнать, как появляются новые признаки. И центром нашего внимания вновь станут регуляторные последовательности ДНК.

Бесконечное число самых прекрасных мушек

Хотя тропические рыбы, бабочки и птицы считаются, вероятно, самыми красивыми представителями царства животных, в царстве биологических исследований найдется мало существ, которые могли бы соперничать с плодовой мушкой, или дрозофилой. Открытие регуляторных генов дрозофилы возродило к жизни биологию развития и способствовало появлению нового направления биологии — эволюционной биологии развития (эво-дево). Не так давно разнообразие окраски крыльев дрозофил (хотя и менее нарядных, чем крылья птиц или бабочек) помогло прояснить механизмы эволюции новых признаков.

У лабораторной плодовой мушки Drosophila melanogaster крылья бледные, но ее многочисленные родственники из того же семейства обладают крыльями с разнообразным черно-белым рисунком (рис. 8.7).

Рис. 8.7. Разнообразие окраски крыльев плодовых мушек. Крылья этих маленьких насекомых — прекрасный пример того, как с помощью одних и тех же генетических инструментов может возникнуть почти бесконечное разнообразие узоров. Монтаж Николаса Гомпела и Бенжамина Прюдомма.


У многих видов характерная окраска присуща только самцам и предназначена для демонстрации самкам в период ухаживания, когда самцы танцуют или прихорашиваются перед своими избранницами. Наиболее типичная окраска — одно черное пятнышко около кончика крыла.

Сотрудники нашей лаборатории в Университете Висконсина занимались изучением происхождения и эволюции пятен на крыльях дрозофил. Эти пятна — превосходная иллюстрация общей закономерности: новые признаки появляются тогда, когда «старые» гены учатся новым трюкам.

Появление пятен на крыльях связано с активностью фермента, синтезирующего меланин (черный пигмент, о котором мы уже говорили в главе 7). Этот фермент можно сравнить с кисточкой в генетическом «наборе инструментов». У насекомых с пятнистыми крыльями эта кисточка прокрашивает заранее заданный рисунок. Форму рисунка контролируют переключатели, окружающие кодирующую область каждого гена-кисточки. В ходе эволюции рисунка крыльев переключатели претерпели несколько изменений. Появление темных пятен с хорошо очерченными краями было не одностадийным процессом («пятен нет — пятна есть»), а последовательной серией изменений, в ходе которых эволюционировала форма рисунка и интенсивность окраски. Так что история «простого» пятна не так уж проста: оно сформировалось постепенно в результате сложения многих мелких вариаций. Мы считаем, что большинство физических признаков эволюционировали таким же образом.

Мы идентифицировали изменения в последовательности переключателя, регулирующего использование одного гена-кисточки в крыле (рис. 8.8).

Рис. 8.8. Появление и исчезновение пятен на крыльях у дрозофил происходит при участии специфических переключателей гена-кисточки. Появление пятнистых крыльев у современных дрозофил, эволюционировавших из предшественника с неокрашенными крыльями, произошло в результате модификации генетического переключателя, контролирующего работу гена окраски в развивающемся крыле (звездочки). Селективная потеря пятен на крыльях (без каких-либо изменений в других частях тела) также произошла в результате модификации этого переключателя (X). Рисунок Лианн Олдс.


Этот ген имеет и другие переключатели, регулирующие его действие в других частях тела (например, в груди и брюшке) или на других стадиях развития (у личинок дрозофил). И вновь существование независимых переключателей позволяет модифицировать действие инструментального гена в одной части тела, не влияя на его действие в других местах. У других видов модификация других переключателей приводила к другим изменениям.

Появившееся на крыле темное пятно передалось по наследству многим дочерним видам. Интересно, однако, что некоторые виды мушек его потеряли. Потеря признака — гораздо более частое явление в природе, чем думают многие. Почему исчезли пятна на крыльях дрозофил? Возможно, самки перестали ориентироваться на этот признак при выборе партнера, половой отбор этого признака ослабел, и пятна исчезли. Мы исследовали механизм исчезновения пятен и обнаружили, что переключатель, позволивший образоваться пятнам на крыльях у предков, накопил мутации и инактивировался (этот сценарий напоминает образование ископаемых генов, о которых я рассказывал в главе 5). Переключатели, подобно белкам, также могут разрушаться под действием мутаций. Разница заключается в том, что инактивация переключателя не приводит к инактивации гена-кисточки, который продолжает участвовать в окрашивании других частей тела.

В результате игр с переключателями генов пигментации у дрозофил появилось множество вариантов окраски крыльев, чему способствовал как естественный, так и половой отбор. Пример этого маленького насекомого очень важен, поскольку показывает, как с помощью одного и того же набора генетических инструментов можно добиться большого разнообразия.

Создаем сложное

Я начал первую главу книги словами Дарвина: «Когда в каждом произведении природы мы будем видеть нечто, имеющее длинную историю; когда в каждом сложном строении или инстинкте мы будем видеть итог многочисленных хитроумных приспособлений, каждое из которых полезно их обладателю… как неизмеримо — говорю на основании личного опыта — возрастает интерес, который представит нам изучение естественной истории!»

Дарвин выбрал термин «хитроумное приспособление» (contrivance) для усиления своей мысли. Ту же терминологию использовал преподобный Уильям Пейли в знаменитой книге «Естественная теология» (Natural Theology, 1802 г.). В существовании «хитроумных приспособлений» в природе Пейли видел доказательство божьего промысла: «Изобретение должно иметь изобретателя, а создание создателя». Дарвин, который был страстным поклонником книги Пейли и утверждал, что почти выучил ее наизусть, оформил многие аргументы в своей книге «О происхождении видов» как прямое опровержение аргументов Пейли в пользу существования создателя.

Преимущество Дарвина перед Пейли и другими мыслителями того времени заключается в способности охватывать большие временные промежутки. Благодаря своим изысканиям в области геологии Дарвин получил представление о мощной кумулятивной силе постепенных изменений, происходящих на протяжении чрезвычайно длинных отрезков времени. Его воображение и, что еще важнее, способность быстро схватывать суть явлений позволили ему выбраться из смирительной рубашки библейской интерпретации возраста Земли. Дарвин понимал, что ему придется собрать огромное количество фактов, отыскать наиболее яркие аналогии и метафоры и изложить материал самым убедительным образом, чтобы преодолеть мощное сопротивление и сомнения ученых и широкой публики. Он предвидел трудности, которые должны возникнуть у людей при попытке понять происхождение сложных структур или «хитроумных приспособлений». Но он знал, что этот труд окупится сторицей.

Количество фактов, касающихся эволюции, продолжает множиться во всех направлениях. Большие достижения в области биологии развития и эво-дево, а также расшифровка летописи ДНК открыли новые перспективы в изучении эволюции и ее истории. Биология развития позволяет исследовать формирование сложных структур в доступном для восприятия временном диапазоне. Киты, черепахи, рыбы, крабы и кораллы барьерного рифа являются сложными существами, но все они начинают свою жизнь со стадии оплодотворенного яйца. Через несколько дней, недель или месяцев они превращаются в целые организмы с многочисленными сложными органами, и суть этого процесса теперь известна нам в мельчайших подробностях. Эво-дево связывает различия между видами, находящимися в ежедневном процессе развития, с длительным процессом эволюционных изменений формы, то есть со «сложением» всех изменений, произошедших в ходе развития видов за многие тысячи и миллионы поколений. А информация, заключенная в ДНК, позволяет реконструировать каждый отдельный этап эволюции.

Идея о создании живых существ усилием какого-то внешнего разума лишилась всех оснований.

Трудно представить, что человек, знакомый со всеми этими фактами, все еще может сомневаться. Эти данные получены благодаря тем же научным и технологическим достижениям, которые позволили выявить генетические причины сотен заболеваний, создать десятки новых средств для генной терапии, реформировать криминалистику и сельское хозяйство. И все же вопреки всем научным доказательствам сомнения и отрицание реальности биологической эволюции по-прежнему нередки. Чтобы понять, откуда эти сомнения и это неприятие, нужно выйти из сферы научных исследований, поскольку причины этих сомнений не могут быть научными и не являются таковыми. Их суть кроется в культурной традиции. Чтобы это понять, лучше всего обратиться к тем моментам в истории человечества, когда некоторые группы людей по личным или идеологическим соображениям отказывались принимать новые научные открытия.

Пришло время для нашей послеобеденной беседы.

Памятник Луи Пастеру на площади Бретей в Париже. Фотография любезно предоставлена Бенжамином Прюдоммом.

Глава 9 Видеть и верить

Мыслить — значит видеть! […] Все человеческое знание основывается на дедукции, на медленном движении от причины к следствию и от следствия к причине.

Оноре де Бальзак «Человеческая комедия» (1845)

Это место называли Домом смерти.

Клиника во французской провинции потеряла так много своих пациенток в результате инфекционных заболеваний (в какой-то момент умерло 16 из 16), что ее основатель обещал поставить золотую статую в честь того, кто решит эту проблему. Врачи, собравшиеся на заседание Медицинской академии в Париже, были в растерянности. Когда некий доктор презрительно отозвался на предположение о том, что болезнь распространяется руками самих врачей, один из присутствовавших в зале воскликнул, вскочив с места: «Женщин убивает то… что вы, врачи, переносите смертельных микробов от больных женщин к здоровым».

Человеком, который это произнес, был Луи Пастер.

Дело было в 1879 г., через 30 лет после того, как врачи Оливер Уэнделл Холмс и Игнац Земмельвейс назвали мытье рук лучшим средством борьбы с родильной горячкой. И уже более 20 лет прошло с тех пор, как Пастер продемонстрировал, что в воздухе тоже полно микробов, которые быстро размножаются в благоприятных условиях, и тем самым развеял миф о самозарождении жизни.

Но микробная теория все еще не получила широкого распространения, а простейшие антисептики не вошли в употребление.

Некоторые европейские доктора и представители духовенства считали, что родильная горячка является божьим наказанием за грех зачатия. Отказаться от этой точки зрения означало признать не только, что смертельную инфекцию вызывают какие-то невидимые существа, но и что переносчиками болезни являются сами врачи.

Это упрямое неверие можно было преодолеть лишь одним способом — предоставить еще больше доказательств. Как раз это и удалось сделать Пастеру и некоторым его современникам. Немецкий микробиолог Роберт Кох с помощью мощного микроскопа обнаружил и идентифицировал микробов, вызывающих сибирскую язву, холеру и туберкулез. Шотландский хирург Джозеф Листер использовал микробную теорию Пастера о брожении и инфекции и придумал средства обеззараживания ран и медицинских инструментов, тем самым на 70 % снизив смертность в результате хирургических операций.

Но, возможно, самыми убедительными оказались результаты деятельности самого Пастера. В 1870-х годах не менее половины овец и коров по всей Франции погибали от сибирской язвы. Несмотря на серьезные трудности, связанные с культивированием возбудителя этого заболевания, Пастеру удалось получить вакцину и успешно применить ее в 1881 г.

Микробная теория послужила основой многих нововведений в системе общественного здравоохранения, в числе которых пастеризация продуктов, а также предотвращение и контроль распространения инфекционных заболеваний. Но мы благодарны Пастеру не только за это, но также за его преданность научному методу. Он великолепно умел оценить все имеющиеся данные и составить на их основе научную теорию, тщательно построить эксперимент для ее доказательства и путем синтеза теории и эксперимента достичь нового знания.

Пастер сформулировал тезис, отражающий важнейшую роль экспериментального доказательства:

Воображение может дать крылья любым нашим мыслям, но всегда следует получить их экспериментальное подтверждение, и, когда приходит момент сделать выводы и интерпретировать наблюдения, то, что мы вообразили, необходимо проверить и подтвердить фактическими результатами эксперимента.

Когда мы заглядываем в прошлое, кажется странным, что врачи так долго не верили в микробную природу инфекции. Однако нужно понять, что их призывали поверить в то, чего они не могли увидеть. Для них, как и для многих из нас, увидеть — означает поверить. Мы гораздо легче верим в то, что видим собственными глазами. На протяжении всей истории развития науки появление новых открытий и новых идей в значительной степени зависело от новых методов наблюдения. Доказательства справедливости микробной теории — под микроскопом, на фермах и в больницах — устранили все сомнения.

Чарльз Дарвин, без сомнения, придерживался той же точки зрения на научные исследования, что и Пастер, но проблема заключалась в том, что в его время его великую теорию не так-то легко было проверить или доказать. Подобно Пастеру, Дарвин постулировал существование в природе невидимых сил, но он не мог сделать животному укол, от которого оно превратилось бы в иное животное, или увидеть в микроскоп, как идет эволюция. Дарвин привлекал в поддержку своей теории все доказательства, какие только мог найти: данные геологии и палеонтологии, результаты селекции домашних животных, сведения натуралистов, исследовавших различные виды растений и животных. Однако длительность эволюционных процессов делала невозможными прямые наблюдения за происходящими изменениями. И, подобно микробной теории, теория эволюции столкнулась с упорным недоверием.

Сегодня, спустя почти 150 лет, мы можем все увидеть своими глазами. Мы больше не смотрим на природное многообразие, как дикарь смотрит на корабль. Заключенная в ДНК информация содержит в себе множество подтверждений эволюции. Но многие — очень многие! — люди либо не видят того, что видят ученые, либо не верят их выводам.

Название этой главы я позаимствовал из замечательной книги Ричарда Панека «Видеть и верить» (Seeing and Believing) об изобретении телескопа и о том, как это изобретение изменило наше отношение к небу и к восприятию своего места во Вселенной. Подобно идеям Дарвина идеи Галилея не были приняты властями, которые не знали, как использовать эти новые факты и теории в своих интересах. Но в конечном итоге зримые доказательства пересилили идеологическое сопротивление. Для всех, кто видит бесспорные доказательства работы естественного отбора и происхождения видов от более древних предков, кто осознает, сколь велик промежуток времени, в течение которого разворачивалась история жизни, кажется, мягко говоря, непостижимым, что столько людей по-прежнему этого не видят и не осознают. Поражает и порой приводит в ярость, что многие люди до сих пор отрицают прочнейшие основы этих доказательств и отметают все великие научные достижения, на которых строятся эти основы.

Если на стороне эволюции факты, отчего эти сомнения и недоверие не исчезают и даже распространяются еще шире — сейчас, в начале XXI в.?

Я выскажу свою точку зрения по поводу неприятия эволюции позже в этой главе. Но сначала я хочу сделать для вас понятнее мотивацию и тактику такого неприятия: мы обратимся к другим моментам в истории, когда научные факты и доказательства упорно игнорировались. Обычно главной иллюстрацией конфликта между наукой и религиозной косностью становится эпизод с Галилео Галилеем. Эту историю пересказывали много раз, да и происходило это очень давно. Кроме того, хотя неприятие эволюции имеет религиозную мотивацию, религия не всегда является причиной сопротивления научным знаниям. И не все религиозные конфессии в штыки воспринимают идею эволюции — на самом деле это далеко не так. Вместо того чтобы ворошить старое, я приведу два удивительных и показательных, хотя и не очень широко известных примера сопротивления развитию биологии в XX в. Первая история относится к периоду 1930–1950-х гг. в Советском Союзе и описывает противодействие генетике и представлениям о ДНК как о носителе наследственной информации. Находившиеся под покровительством власти фанатики практически уничтожили биологию в СССР, что привело к трагическим последствиям для науки, ученых и всей страны. Вторая история рассказывает о мануальных терапевтах (хиропрактиках), их неприятии микробной теории болезней и активном сопротивлении развитию науки и медицины, в частности проведению вакцинации.

Французские врачи, советские биологи и хиропрактики, о которых я расскажу далее, поставили идеологию и личный интерес выше истинного научного знания, как и современные противники эволюции. Луи Пастер говорил: «Знания — это наследие человечества». Сохранение и умножение этого наследия требует от нас понимания мотивов и стратегии тех, кто ему угрожает. А если требуется, то и открытого противостояния их заблуждениям.

Комиссар советской биологии

Трофим Денисович Лысенко (1898–1976), выходец из крестьянской семьи, получивший весьма скудное образование, стал депутатом Верховного Совета СССР, академиком трех научных академий и директором Института генетики АН СССР Он трижды был лауреатом Сталинской премии, имел звание Героя Социалистического Труда и был награжден орденом Ленина (высшей наградой страны) восемь раз. Более 25 лет Лысенко руководил советской биологией, медициной и сельским хозяйством.

И все это он разрушил.

Рис. 9.1. Трофим Денисович Лысенко.


В истории Лысенко много глав. О его восхождении к власти, политических интригах и участии в сталинских репрессиях, о том, как он долгое время, несмотря на полную научную безграмотность, оказывал огромное влияние на советскую биологию, написано несколько книг. Наиболее ярко и проникновенно об этом рассказали ученые, ставшие жертвами лысенковщины — или советской политической системы. «Взлет и падение Лысенко» Жореса Медведева и «Власть и наука»[19] Валерия Сойфера — отрезвляющие книги, написанные смелыми людьми, которые многим пожертвовали в борьбе за правду.

В своем коротком рассказе я не буду подробно обсуждать эту трагедию и страдания ученых, пытавшихся противостоять Лысенко. Я хочу лишь обратить ваше внимание на то, как научная истина была принесена в жертву идеологическим или политическим интересам и как по политическим мотивам была выхолощена советская биологическая наука. Западному человеку трудно представить себе масштаб лжи в советской науке в эпоху Лысенко и судьбу противников этой общей линии. Однако культурное влияние этого явления и питавшие его интересы не являются уникальными и не ограничены прошлым.

Генетика как буржуазная наука

В начале XX столетия, после повторного открытия работ Менделя, Томас Морган провел фундаментальные исследования природы генов и механизмов наследования. За эти эпохальные открытия, моделью для которых послужили плодовые мушки, в 1933 г. Морган был удостоен Нобелевской премии. Выявление роли генов в качестве особых клеточных элементов, подверженных мутациям, объясняло как постоянство, так и изменчивость видов. Во всем мире, включая Советский Союз, генетика была признана одной из ведущих областей науки.

Но тут вмешался Т. Д. Лысенко.

Впервые о Лысенко заговорили в период его работы на селекционной станции в городе Гяндже (Азербайджан).

Станция была частью института, которым руководил Николай Вавилов — выдающийся ученый, один из самых известных советских биологов того времени. Вавилов был учеником Уильяма Бэтсона — английского ученого, пропагандиста идей Менделя и изобретателя термина «генетика». Вавилов работал во многих уголках мира и собрал уникальную ботаническую коллекцию; его хорошо знали за границей. Одной из важнейших задач, стоявших перед сельским хозяйством СССР в послереволюционные годы, было повышение урожайности зерновых культур. В годы коллективизации (1928–1932) в Советском Союзе урожаи зерновых и поголовье скота резко сократились.

Рис. 9.2. Николай Вавилов. Всемирно известный ботаник (слева) и заключенный (справа), умерший в тюрьме в 1943 г.


Лысенко был занят проверкой идеи о том, что растения северных широт, в частности горох, могут переживать зиму и готовить почву к весенним посадкам хлопчатника. Лысенко повезло, поскольку первая зима оказалась достаточно мягкой и эксперимент прошел удачно. Газета «Правда» сделала из этого сенсацию, Лысенко был назван «босоногим профессором», у которого «теперь есть последователи, ученики, опытное поле, куда зимой приезжают светила агрономии, стоят перед зелеными полями станции, признательно жмут ему руку». Этот простой крестьянин хорошо понял всю силу пропаганды. Эксперимент, однако, повторить не удалось, и следующей зимой урожай гороха погиб.

Затем Лысенко заинтересовался яровизацией — методом получения урожая озимых культур путем выдерживания семян летнего урожая при пониженной температуре. «Правда» вновь писала о Лысенко, когда его отец посеял такие семена на опытном участке в своей деревне. Газета сообщала о необычайном успехе «эксперимента», называя его «невероятным открытием… подтвержденным выдающимися экспериментальными результатами», «перспективы которых так широки, что не могут быть оценены немедленно». На основании архивных данных Валерий Сойфер утверждает, что сообщения о большом урожае были ложью, а мотивы этой лжи объясняет следующим образом:

Они разом уверовали в могущество чуда и решили, что жар-птица у них в руках и их не бес попутал, прельстив возможностью замены реальной (и серьезной) работы мифами, якобы способными разом решить все проблемы. Но мифами была пронизана вся советская жизнь, все ожидания близкого наступления коммунизма, светлое будущее грезилось не во сне, а в ближайшей перспективе. В связи с этим очень подходили и личности передовиков — простых людей, «рожденных сказку сделать былью».

Лысенко активно пропагандировал яровизацию и был выдвинут на должность руководителя лаборатории яровизации только что созданного Института селекции и генетики в Одессе. Здесь он начал развивать теорию, объясняющую суть процесса. Он заявил, что изменения в наследственности растений происходят в ответ на изменения окружающей среды. Эта идея была абсолютно ламаркистской, поскольку подразумевала, что организмы могут передавать потомству признаки, приобретенные на протяжении их жизни. Эта теория была очень созвучна советской философии, ведь она утверждала, что природе и человеку можно придать какую угодно форму незвисимо от истории или наследственности.

Но идеи Лысенко шли вразрез с открытиями быстро развивающейся генетики. И жребий был брошен. Конфликт между Лысенко и генетиками, включая бывшего руководителя Лысенко Вавилова, определил развитие советской биологии на 10 лет вперед.

Популярность Лысенко росла. Народные комиссары и партийные функционеры слышали лишь то, что хотели услышать, и подчиненные Лысенко быстро научились поставлять ему только те результаты, которых он ждал. Под его руководством была запланирована крупномасштабная программа яровизации многих культур, причем без каких-либо предварительных исследований. Прежде чем потеря одного урожая была зарегистрирована, уже высевали новую культуру. Положительные результаты, о которых докладывал Лысенко, часто были основаны на небольших выборках, на неточных и/или сфальсифицированных данных, почти всегда — без проведения контрольных экспериментов.

«Успехи» Лысенко создали серьезные проблемы для селекционеров, применявших для выведения новых сортов растений генетические методы. Небольшой, но постоянный приростурожайности, получаемый селекционерами, не удовлетворял партийных боссов, которые требовали немедленных и весомых результатов.

Конфликт между Лысенко и его сторонниками, выдававшими немедленные «практические» результаты, с одной стороны и теми, кто занимался «чистыми исследованиями» на дрозофилах, с другой быстро нарастал. Оказалось, что «проблема» генетики не только в том, что она отвлекает от насущных нужд советского сельского хозяйства, но и в том, что она является несостоятельным и, хуже того, реакционным и буржуазным направлением. Генетические исследования показывали, что развитие природы и человека ограничено наследственностью, а это шло вразрез с советской философией.

Лысенко стал любимцем партии и многократно встречался с партийными лидерами. Выступая перед колхозниками в Кремле в 1935 г., он заявил: «И в ученом мире, и не в ученом мире, а классовый враг — всегда враг, ученый он или нет». Сталин зааплодировал и воскликнул: «Браво, товарищ Лысенко, браво!»

Одобрение Сталина еще больше подняло авторитет Лысенко и воодушевило его, и его нападки на генетиков усилились. «Новая теория» наследственности, выдвинутая Лысенко, отвергала существование генов и самовоспроизводящегося наследственного материала.

Противостояние с генетиками становилось все более открытым и злобным. К дискуссии присоединились партийные лидеры, связавшие работу генетиков с растущей угрозой фашизма и нацизма. Один из наркомов[20] назвал генетику «служанкой ведомства Геббельса», имея в виду гитлеровское министерство пропаганды.

При этом результаты сельскохозяйственной деятельности Лысенко были катастрофическими. Урожайность яровизированной пшеницы оставалась низкой, производство овощей сократилось, а картофельная программа не дала желаемых результатов. Гибель урожая усугубляла проблему постоянной нехватки продовольствия. Генетики утверждали, что если бы академик Лысенко уделял больше внимания принципам современной генетики, это облегчило бы его работу, что, отвергая генетику и генетические основы селекции, он не предлагает взамен ничего нового.

В 1939 году Центральный Комитет партии санкционировал «открытую» дискуссию между двумя противоборствующими лагерями. Бывший руководитель и сторонник Лысенко Николай Вавилов сказал следующее: «…позиции Лысенко находятся в противоречии не только с группой советских генетиков, но и со всей современной биологической наукой… Под названием передовой науки нам предлагают вернуться, по существу, к воззрениям, которые пережиты наукой, изжиты, то есть к воззрениям первой половины или середины XIX века… то, что мы защищаем, есть результат огромной творческой работы, точных экспериментов, советской и заграничной практики».

Лысенко же отвечал, что не признает менделизма, а формальный менделизм-морганизм не считает наукой.

Философ Павел Юдин добавил, что преподавание генетики в средней школе должно быть запрещено.

Спустя месяц после этого собрания Сталин вызвал к себе Вавилова. Когда ученый попытался объяснить вождю научные основы своих исследований, Сталин никак не отреагировал и вскоре распрощался с ним.

Аресты и расстрелы

Весной 1940 г. началась Вторая мировая война, а в СССР возникли новые сельскохозяйственные проблемы. В это время Вавилов находился в научной экспедиции, задачей которой было оценить состояние развития сельского хозяйства и выработать необходимые рекомендации. Это была уловка, направленная на то, чтобы удалить его из поля зрения властей.

Вавилов был на Украине, когда за ним под видом срочного дела из Москвы приехали сотрудники НКВД. Ученого арестовали по обвинению в том, что он «ведет борьбу против теории и работ Лысенко… имеющих решающее значение для сельского хозяйства СССР».

Вскоре Лысенко вытеснил всех генетиков, работавших с Вавиловым или под его руководством. Он также провел чистку биологического факультета Ленинградского университета. Многие ученые были обвинены по доносам, арестованы и приговорены к расстрелу. Многие другие были уволены и были вынуждены искать себе другую работу. Институты закрывались, учебники переписывались. На Международном конгрессе генетиков в Эдинбурге в 1939 г. не присутствовал ни один советский ученый, хотя Вавилов был выбран его председателем[21].

В ожидании суда Вавилов был помещен в тюрьму. Лишь за день до суда ему предъявили обвинение, в котором фигурировали измена, саботаж, шпионаж и контрреволюционная деятельность. Суд длился пять минут, и Вавилов был приговорен к расстрелу.

Вавилов неоднократно обращался к властям с просьбой о помиловании, и приговор был смягчен[22]. Но при приближении немецких войск к Москве Вавилова перевели в другую тюрьму. Здоровье его было подорвано. В январе 1943 г. самый признанный и уважаемый советский биолог, который при избрании был самым молодым академиком АН СССР, бывший президент Советского географического общества, лауреат Ленинской премии, умер в тюрьме в возрасте 55 лет.

Атмосфера «лысенковщины» сохранялась в советской биологии еще многие годы. В 1953 году умер Сталин, и бразды правления взял в свои руки Никита Хрущев. А еще в 1953 г. Уотсон и Крик открыли структуру ДНК. Казалось бы, это окончательное доказательство природы наследственности должно было нанести последний удар по Лысенко и его сторонникам.

Но нет.

Отрицание ДНК

Советской прессе понадобилось три года, чтобы наконец признать великие открытия молекулярной генетики. Переводы статей о ДНК были опубликованы в газетах и научных журналах, но Лысенко стоял на своем: «Невозможно приписать признаки жизни, то есть наследственность, неживой материи, например дезоксирибонуклеиновой кислоте».

В августе 1961 г. в Москве прошел Международный биохимический конгресс. Здесь должны были собраться самые выдающиеся представители западной биологии, и это предоставляло советским ученым возможность вновь занять свое место в научном мире. Западные ученые считали, что эпоха Лысенко прошла. Они ошибались: многие из организаторов конгресса были сторонниками Лысенко.

Как пишет Жорес Медведев, они боролись против идеи о том, что ДНК играет роль в передаче наследственности. Признание роли ДНК заставило бы их отказаться от идеи наследования приобретенных признаков.

В книге «Восьмой день творения» (The Eighth Day of Creation) Хорас Джадсон рассказывает о том, как биохимик Владимир Энгельгардт описывал визит Лысенко в его институт[23]:

Лысенко говорит: «Все ДНК да ДНК! Все говорят о ней, но никто ее не видел!»

Я говорю: «Но, дорогой Трофим Денисович, я могу показать вам образец ДНК, химики хорошо знакомы с эти веществом». «Покажите, пожалуйста».

«Посмотрите сюда, это ДНК», — говорю я.

Лысенко смотрит. «Ха, да это бессмыслица! ДНК — это кислота. А кислота — это жидкость. А это порошок. Это не может быть ДНК!»

Время открытия конгресса в Москве совпало с величайшими событиями мирового масштаба. В области биологии Советский Союз значительно отставал, но лидировал в сфере освоения космоса. Только что космонавт Герман Титов вернулся из первого суточного полета вокруг Земли, и для его выступления была использована самая большая аудитория, предназначавшаяся для биологического конгресса. А через четыре дня после открытия конгресса возник и самый угрожающий символ разделения Востока и Запада: Хрущев начал строительство Берлинской стены.

В среде биологов были свои потрясения: мало кому известный в то время американский биохимик Маршалл Ниренберг[24] сообщил о начале расшифровки генетического кода и об открытии механизма перевода последовательности РНК в белок (см. главу 3). Это событие стало кульминацией конгресса.

Открытие Ниренберга вселило надежду в тех, кто пытался преодолеть влияние Лысенко. В начале 1962 г. Ж. Медведев отправил Ниренбергу поздравительную открытку:

Возможно, вы знаете о долгой и серьезной дискуссии о наследственности, начатой Лысенко и казавшейся бесконечной. Новые экспериментальные данные относительно проблемы кодирования предоставляют хорошее основание для урегулирования этого спора. Поэтому я вижу в этом достижении не только большое открытие естественных наук, но и важный этап, который может повлиять на ситуацию в генетике здесь…

Но сторонников Лысенко это достижение не убедило.

После конгресса политическая борьба продолжилась. В 1962 году в самиздате вышла книга Медведева, рассказывающая о восхождении Лысенко и о его многочисленных ошибках. Книгу запретили, но она стала известна широкому кругу ученых.

В 1967 году книгу Медведева все-таки опубликовали в СССР, но, когда она также вышла в США в 1969 г., автора уволили с работы[25]. Он стал одним из первых диссидентов, помещенных в психиатрическую больницу — якобы в связи с признаками «начинающейся шизофрении». Под давлением Запада через четыре года власти разрешили Медведеву покинуть СССР.

Период влияния Лысенко на советскую биологию совпал по времени с величайшей «молекулярной революцией» в биологии. Трудно представить себе, как можно откровенно отрицать законы генетики и представление о ДНК и упорно не признавать ошибочность идей Лысенко. Но, когда вопрос упирается в идеологию, любое количество доказательств оказывается недостаточным. Если учесть, чем грозило ученым несогласие с общим идеологическим направлением, становится понятнее, почему они не решались нарушить статус кво. Многие советские биологи дорого поплатились за свои смелые высказывания.

Влияние Лысенко вышло за пределы СССР. Лидер коммунистической партии Китая Мао Цзэдун провел коллективизацию сельского хозяйства Китая примерно по такой же схеме. Урожаи падали, поэтому Мао приказал крестьянам использовать методы, предложенные Лысенко и его сторонниками: более густые посадки, глубокая вспашка, отказ от применения удобрений и активная борьба с вредителями. Все эти меры окончательно подорвали состояние сельского хозяйства страны. Автор книги «Голодный призрак: секретный голод Мао» (Hungry Ghosts: Mao’s Secret Famine) Джаспер Беккер пишет, что в 1958–1961 гг. от голода умерло от 30 млн до 40 млн китайцев.

Однако было бы слишком большим упрощением объяснять подобные трагедии исключительно культурными особенностями Китая или Советского Союза и отсутствием у граждан правовых свобод. В США люди вольны думать как им заблагорассудится, но и здесь «образованные» люди с потенциально добрыми намерениями не менее склонны впадать в заблуждения.

Костоломы

Концепция хиропрактики (это слово происходит от греческих слов χερι — «рука» и πρακτικη — «практика», «действие»), или мануальной терапии, была основана Даниэлем Давидом Палмером в конце XIX в. Этот житель Среднего Запада и торговец бакалейными товарами занимался «магнетическим целительством». Однажды он лечил пациента, потерявшего слух в результате несчастного случая. Обычные средства Палмера не действовали, но он обнаружил на шее пациента, вблизи четвертого шейного позвонка, огромную шишку. Палмер подумал, что, если вставить позвонок на место, слух может вернуться. Палмер вправил позвонок, и пациент сразу стал слышать. Эта история кажется весьма неправдоподобной, поскольку слуховой нерв не проходит через шею, но тем не менее это был поворотный момент в жизни Палмера, ознаменовавший рождение хиропрактики.

Палмер создал теорию, в соответствии с которой практически все болезни имеют неврологическую природу и вызываются защемлением нервов в результате смещения позвонков. Палмер основал в Айове школу (которая существует и по сей день) и начал обучать других своему методу врачевания позвоночника. Руководить школой стал сын Палмера, Бартлет Джошуа. Палмер-младший развил идею отца о том, что хиропрактика лечит путем удаления препятствий на пути циркулирующей в теле жизненной силы, или «природного разума», и позволяет телу исцелить себя.

Этот основополагающий принцип противоречил принятой в медицине концепции о том, что источником инфекционных заболеваний являются микробы. Палмер-младший отвергал господствующее мнение о передаче инфекционных заболеваний: «Причины всех болезней, считавшихся заразными, хиропрактики нашли в позвоночнике». Противостояние хиропрактиков микробной теории инфекционных заболеваний привело к сопротивлению вакцинации, которое продолжается и сегодня. Один из наиболее неприятных и выразительных эпизодов относится к периоду создания вакцины от полиомиелита.

В 1954 году, за год до того, как стала применяться разработанная Йонасом Солком вакцина против полиомиелита, в США было зарегистрировано 38 476 случаев этого заболевания. В 1955 году их было 28 985, в 1956 г. — 15 140, а в 1961 г. — всего 1312.

Пока представители официального здравоохранения направляли свои усилия на повсеместное проведение вакцинации, хиропрактики действовали по своей программе. Их заявления были поразительно безграмотны и даже опасны. Некоторые из них оспаривали полезность вакцин — в частности, в журнале Национальной ассоциации хиропрактиков была опубликована статья «Провалилась ли война пробирок против полиомиелита?». В этой статье предлагалось не вводить вакцину, а «полностью выправить кости позвоночника в первые три дня после начала острой формы заболевания».

По данным главного государственного врача США девять из десяти новых случаев полиомиелита возникали у людей, не сделавших прививку (использование вакцины Солка требовало введения нескольких доз).

Хиропрактики утверждали, что умеют успешно лечить больных как с хронической, так и с острой формой заболевания, причем при острой форме полное выздоровление наступало в 71 % случаев. О том, что 60 % заболевших самостоятельно выздоравливали без остаточных симптомов мышечной слабости или паралича, хиропрактики умалчивали. Пациентов с более серьезной формой заболевания лечили традиционные врачи и применяли при этом такие активные меры, как трахеотомия, введение питательной трубки или использование аппарата для искусственного дыхания. Хиропрактики ничего этого не делали, они просто приводили в порядок позвоночник.

Недостаток знаний для постановки диагноза или определения причин заболевания не мешал хиропрактикам удерживать людей от вакцинации. В Колорадо циркулировал такой памфлет: «Задумайтесь над тем, что загрязнение человеческого тела путем впрыскивания клеток больных животных должно быть отвратительно Создателю, снабдившему нас нашими собственными клетками, которые не должны смешиваться с клетками животных».


Казалось бы, за 50 лет успешного применения вакцин против полиомиелита вся эта бессмыслица должна была остаться позади. К сожалению, это не так.

Проведенный в 1994 г. опрос 171 хиропрактика показал, что треть опрошенных не верили в возможность предотвращения болезней с помощью иммунизации. Опрос, проведенный в 1998 г. в Бостоне, показал, что только 30 % хиропрактиков являются активными сторонниками вакцинации, 7 % являются ее активными противниками, а 63 % не дают никаких рекомендаций по этому поводу. В 2002 году опрос канадских студентов, обучавшихся мануальной терапии, показал последовательное снижение веры студентов в действенность вакцинации по мере продвижения их учебы. Так, четверть студентов четвертого курса соглашались с тезисом о том, что «существует мало научных доказательств предотвращения инфекционных заболеваний посредством вакцинации».

Хиропрактики практикуют то, что проповедуют. Социологические данные за 1999 г. показали, что 42 % хиропрактиков не вакцинируют своих детей. При всем обилии доказательств действенности прививок против оспы (которая практически исчезла), полиомиелита, дифтерита, столбняка, кори, свинки, краснухи, гепатита и других болезней кажется невероятным, что образованные люди могут придерживаться столь неразумных взглядов, потенциально опасных для их пациентов и семей. К примеру, в США по данным за 1998 г. первым от дифтерии погиб сын мануального терапевта, не верившего в пользу иммунизации.

В какой-то степени понять это отсутствие здравого смысла позволяют высказывания тех мануальных терапевтов, которые не отвергают идею вакцинации. Так, два мануальных терапевта из Канады, Джейсон Басси и Стефан Инжеян, публикующие статьи в весьма уважаемом медицинском журнале Pediatrics, совместно со своим коллегой-микробиологом Джеймсом Кэмпбеллом перечислили и объяснили некоторые аргументы против проведения иммунизации, которые используют хиропрактики и другие специалисты близкого профиля. Эти аргументы и тактику стоит изучить, поскольку они очень напоминают аргументы противников эволюции. В обоих случаях противниками науки движут похожие мотивы.

Ниже представлено шесть основных аргументов против прививок.


1. Недоверие к науке.

Хиропрактики считают, что исчезновение некоторых инфекционных заболеваний связано не с проведением вакцинации, а с другими причинами. Они указывают на циклический характер распространения инфекций и предполагают, например, что сокращение числа случаев полиомиелита является частью естественного цикла. В качестве причин исчезновения инфекций они называют такие меры, как повышение уровня гигиенических и санитарных норм. Они полностью игнорируют результаты обширных клинических испытаний или объявляют их поддельными, что непосредственно подводит ко второй линии атаки.


2. Сомнение в честности научной мотивации.

Противники вакцинации заявляют не только о подделке научных результатов, но и о сговоре между врачами и фармацевтическими кампаниями. Они утверждают, что поддержка вакцинации мотивирована не заботой о здоровье населения, а финансовой выгодой.


3. Преувеличение разногласий между учеными, ссылки на маргинальные точки зрения как на авторитетные.

Спорные вопросы существуют в любой области науки. В области иммунизации также существует множество вопросов, касающихся времени введения и дозы вакцин, необходимости введения бустер-доз, риска и преимуществ для людей с ослабленным иммунитетом (например, больных СПИДом, тех, кто проходит курс химиотерапии, или стариков). Хиропрактики представляют эти технические разногласия в виде принципиальных проблем, ставящих под сомнение ценность иммунизации. Другая тактика состоит в цитировании наиболее откровенных критиков вакцинации среди самих врачей вне зависимости оттого, насколько маргинальными и бездоказательными являются их утверждения.


4. Преувеличение возможного риска.

Вакцинация, как и любая другая медицинская процедура, сопряжена с определенным риском, который зависит от типа вакцины и группы населения. Случаи нежелательного побочного действия прививок строго документируются и предаются огласке; об этих рисках всегда сообщают вакцинируемым. Противники вакцинации часто подчеркивают или преувеличивают риски при вакцинации, но при этом умалчивают о риске и последствиях при отказе от прививки и заражении.


5. Обвинение в нарушении прав личности.

Обязательная вакцинация детей школьного возраста воспринимается некоторыми людьми как неприемлемое нарушение личных и родительских прав, «тайный сговор, призванный разрушить основы американских свобод», как заявил один хиропрактик из Денвера. Верховный суд отклонил эту жалобу на том основании, что безопасность всего общества стоит выше мнения отдельных людей.


6. Несовместимость с ключевыми принципами хиропрактики. В конечном итоге, по мере того как туман дезинформации рассеивается и эффективность вакцин становится все более очевидной, большинство аргументов теряют свою силу. Последним аргументом противников вакцинации является то, что вакцинация несовместима с так называемой основной предпосылкой хиропрактики. Эта предпосылка заключается в том, что все заболевания происходят в результате смещения позвонков, и, по словам Кэмпбелла, Басси и Инжеяна, «принимается на веру и закрыта для научной критики». Р. Б. Филлипс пишет в Journal of Chiropractic Humanities: «Этот основанный на вере подход отрицает необходимость индуктивного мышления, содержащего в себе элемент вероятности, поскольку абсолютная истина уже известна и каждому остается лишь подтвердить ее путем личного опыта».


Великая ирония заключается в том, что хиропрактики, отрицающие научные основы вакцинации, никогда не проверяли свои методы в таких же двойных слепых испытаниях. Доктор медицины и доктор хиропрактики Роберт Андерсон отмечает, что хиропрактики «оценивают все медицинские параметры в символических терминах, таких как вред и опасность», а их «идеи никогда не подвергались проверке в клинических испытаниях или в лабораторных экспериментах, поэтому они остаются в сфере веры, а не научного доказательства. Нежелание признавать пользу вакцинации служит консервативным хиропрактикам понятным культурным [курсив автора] символом».

Андерсон ухватил самую суть этого неприятия — оно имеет культурную, а не научную основу.

Как видно из высказываний Басса, Инжеяна и Андерсона, не все хиропрактики придерживаются подобных воззрений. Но все же таких достаточно много, и это указывает на приоритет культурной идеологии по отношению к доказательной науке. И это вновь подводит нас к теме эволюции.

Отрицание эволюции

В наши дни отрицание эволюции подразумевает отрицание гораздо большего объема информации, чем скромные генетические данные, имевшиеся у советских биологов в 1930-х гг., или данные иммунологии и вирусологии, отвергавшиеся хиропрактиками в 1950-х гг. Отрицание эволюции означает отрицание основ биологии и геологии, заложенных за последние 200 лет. Это своеобразное геройство требует объяснения.

Безусловно, отрицание теории эволюции имеет долгую историю. Я не ставлю перед собой задачу пересказать ее (в конце книги вы найдете список литературы на эту тему) и только изложу на нескольких страницах самую суть этого явления. Моя цель состоит в том, чтобы снабдить вас некоторым фактическим материалом для дискуссии, которая может возникнуть за обеденным столом, на работе или, что гораздо важнее, в школе, где учатся ваши дети.

Я убежден, что отрицание эволюции, как и многих других вещей, не имеет ничего общего с наукой. И не может иметь. Причины отрицания кроются в идеологии, в данном случае — в религиозной идеологии. Хотя противники эволюции выражают недоверие к имеющимся доказательствам и утверждают, что у них есть некие противоположные научные данные, это лишь дымовая завеса — такая же, как применялась хиропрактиками, боровшимися с вакцинацией. Нужно пройти сквозь эту завесу, чтобы определить истинные мотивы неприятия. Я проиллюстрирую тактику оппонентов эволюции прямыми цитатами из их высказываний. Я сделаю это, во-первых, чтобы быть точным, а во-вторых, чтобы передать настрой наиболее ярых критиков эволюции. Их аргументы и тактику я разделю на те же шесть категорий, что и аргументы хиропрактиков, противившихся проведению вакцинации.

1. Недоверие к науке.

Часто можно натолкнуться на такие общие утверждения, как «не существует практически никаких научных доказательств эволюции» (Т. Безеля, Christianity Today, 3 сентября 2001 г.), «не существует реальных научных доказательств того, что эволюция происходит сегодня или происходила когда-то в прошлом… […] Эволюция не является научным фактом, как многие утверждают. На самом деле она вообще не имеет отношения к науке» (Г. Моррис, Impact, декабрь 2000 г.) или «эволюция — это миф, лишенный всякого научного доказательства» (Ф. Фернандес, докторская диссертация, Институт защиты Библии, 1997).

Подобные тезисы часто представляют как логические выводы из разнообразных аргументов, опровергающих теорию эволюции. Два самых распространенных аргумента касаются отсутствия среди палеонтологических находок «переходных форм» и роли случайных мутаций. Оба аргумента основаны на фундаментальном (возможно, преднамеренном) непонимании фактов и составляющих эволюционного процесса.

На самом деле палеонтологи идентифицировали множество окаменелостей, чьи характеристики являются промежуточными между характеристиками различных групп организмов. Наиболее яркие примеры — переходные формы в эволюции лошадей, знаменитый археоптерикс, обладавший признаками птиц и рептилий, пернатые динозавры, а также ранние формы четвероногих позвоночных. По мере накопления данных о разнообразии видов, существовавших в определенные исторические периоды, палеонтологи смогли обнаружить множество промежуточных стадий эволюции ключевых признаков. В качестве примера несправедливого утверждения об «отсутствии переходных форм» можно привести высказывание биохимика Майкла Бехе, сторонника идеи «разумного замысла», о которой я коротко расскажу ниже.

В 1994 году он заявил, что не найдено переходных форм, связывающих первых ископаемых китов и их наземных предков мезонихий. И именно в этом году были обнаружены три переходные формы. Подобные примеры должны бы развеять этот исчерпавший себя аргумент, но его по-прежнему продолжают выдвигать.

Наиболее нелепые антиэволюционные заявления касаются вопросов мутаций и генетики.

«Эволюционистам нужен механизм, объясняющий предполагаемый ход эволюции. Многие эволюционисты считают, что этим механизмом являются мутации» (Г. М. Моррис, «Наука и Библия»).

«Однако… мутации только портят уже существующий генетический код. Новая генетическая информация не появляется» (там же).

«Но, чтобы эволюция могла иметь место, необходим механизм образования новых генов. Поэтому мутации не могут объяснить эволюцию. Эволюционисты заявляют, что настоящее объясняет прошлое. Однако не существует механизма, спонтанно производящего новую генетическую информацию. Пока такой механизм не найден, для принятия эволюции требуется „слепая вера“» (Ф. Фернандес, докторская диссертация, Институт защиты Библии).

По-видимому, Ф. Фернандес изучал генетику по книге Генри Морриса «Наука и Библия», поскольку достаточно поверхностно ознакомиться с любым учебником по генетике, чтобы узнать об удвоении генов, рекомбинации, инсерционных мутациях, транспозиции и транслокации. Любой из этих процессов может приводить и приводит к появлению новой генетической информации, не говоря уже о точечных мутациях, способных обеспечить появление новых функций, о чем говорят многочисленные примеры в этой книге.

Ошибочное заявление о том, что все мутации являются вредными, так часто встречается в работах противников эволюции, что воспринимается как общепринятая истина. Между тем биологи еще на заре существования генетики знали, что это не так.

Кроме путаницы в технических вопросах излюбленной тактикой противников эволюции остается смешение понятий «гипотеза», «факт» и «теория» в биологии. Хотя в бытовом языке слова «теория» и «гипотеза» часто являются синонимами, обозначающими то или иное предположение, а слово «факт» означает что-то более твердо установленное, в науке под словом «теория» понимают нечто большее. Национальная академия наук США определяет научную теорию как «хорошо доказанное объяснение какого-либо аспекта природы, которое может включать в себя факты, законы, выводы и проверенные гипотезы». Когда ученые говорят о «теории» эволюции, они не демонстрируют отсутствие уверенности, как хотят показать их оппоненты, а просто используют формальное определение.

Папа римский Иоанн Павел II хорошо это понял, о чем свидетельствует его заявление, опубликованное в 1996 г. в L’Osser-vatore Romano:

Новые знания привели к признанию того, что эволюция есть нечто большее, чем гипотеза. На самом деле замечательно, что в результате серии открытий в разных областях знания эта теория принимается все более широким кругом ученых. Непреднамеренное и несфабрикованное совпадение результатов, полученных в независимых исследованиях, само по себе является серьезным аргументом в пользу этой теории.

Выбранная папой манера изложения свидетельствует о ясном понимании силы доказательств и путей достижения консенсуса в научных изысканиях.

2. Сомнение в честности научной мотивации.

Важнейшим мотивом отрицания эволюции является представление о том, что ее питает атеистическая философия. В качестве наиболее яркого примера я приведу высказывание Кена Камминга из Института креационных исследований по поводу выхода телевизионной программы «Эволюция», подготовленной американской телевизионной службой Public Broadcasting Service (PBS) в сентябре 2001 г.

Всего через 13 дней после террористического акта в Нью-Йорке [PSS] осуществила другое, но также очень важное действие, свидетелями которого стали миллионы американцев, — это выпуск восьмичасовой передачи из семи частей, названной «Эволюция». PBS… нанесла один из самых чудовищных ударов как по нашим школам с миллионами невинных детей, так и по всем основам мировоззрения, на которых держится наша нация. Эти два удара имеют похожую историю и близкие цели. Люди ничего не знали о шедшей на протяжении нескольких последних лет подготовке к этим событиям… Агрессивное религиозное движение философов-натуралистов (то есть атеистов) под маской светского дарвинизма атаковало Америку изнутри, через ее систему образования. Оба события имели целью изменить жизнь и образ мысли нашей нации.

Я прокомментирую это сообщение чуть ниже, в шестом пункте данного списка, прибегнув к помощи епископа Оксфордского.

3. Преувеличение разногласий между учеными.

Начиная со времен Дарвина биологи пытались понять механизм биологической эволюции и пролить свет на историю развития жизни. Каждый элемент этой работы — от изучения относительного вклада различных генетических механизмов в процесс эволюции до анализа родственных взаимоотношений между видами — складывался в результате тестирования альтернативных гипотез. Но технические разногласия, которые возникали на этом пути, как это и должно быть в любой здоровой науке, не следует воспринимать как несогласие с самим фактом существования эволюции, то есть с происхождением живых организмов от предшественников и их изменением во времени под действием естественного отбора.

Даже среди людей с научным образованием и дипломами есть такие, кто ставит под сомнение или отвергает отдельные элементы эволюционной теории, принятые широкой научной общественностью. А некоторые сомневаются в справедливости всей теории в целом. Но получить научную степень и критиковать других сравнительно легко, совсем другое дело — находить новые факты и доказательства. Противники теории эволюции специализируются на риторике и цитатах, а не на лабораторных исследованиях.

4. Преувеличение возможного риска.

Противники теории эволюции видят в ней серьезную опасность и значительную долю ответственности за сложности в развитии общества возлагают на влияние «дарвинизма» на современную культуру. Президент и основатель креационистской организации «Ответы в Книге Бытия» (Answers in Genesis) Кен Хэм видит связь между преподаванием теории эволюции и распространением насилия в школьной среде:

Сторонники эволюционной идеи провозглашают, что мы лишь животные, участвующие в борьбе за выживание. У многих молодых людей эта идея формирует мнение о том, что жизнь не имеет смысла… Некоторые студенты, подвергнутые подобному промыванию мозгов, считают, что жизнь состоит из смерти, насилия и кровопролития, поскольку в конечном итоге именно таков путь эволюции.

Некоторые связывают теорию Дарвина с советской моделью коммунизма. Например, Кел Томас[26] в своей авторской колонке так отреагировал на заявление папы римского, сделанное в 1996 г.: «Он принял философию, лежащую в основе коммунизма. Зачем ему понадобилось соглашаться с мировоззрением, против которого он возражал всю жизнь?» Это заявление выглядит очень странно в свете позиции Лысенко по отношению к генетике и дарвиновской теории эволюции.

Еще обвинение в адрес теории эволюции касается связи между нацизмом и дарвиновским представлением о борьбе за существование. Так, Джерри Бергман[27] пишет: «Одним из наиболее важных факторов, породивших нацистский холокост и Вторую мировую войну, является дарвиновская идея о том, что эволюционный прогресс происходит главным образом в результате устранения слабейших в борьбе за существование». Он заключает: «Если Дарвин прав, Гитлер был нашим спасителем, а мы его распяли… Если Дарвин не прав, то, что сделал Гитлер, должно быть приравнено к самым гнусным преступлениям в истории, а Дарвина следует назвать автором одной из самых разрушительных философских теорий».

Раздувая из эволюционной науки политическую философию, Бергман и другие пытаются дискредитировать научные знания. Генетик и писатель Стив Джонс называет такое притягивание теории Дарвина к политическим проблемам «вульгарным дарвинизмом». Он пишет: «Эволюция — это политическое кресло, которое принимает форму ягодиц последнего из тех, кто на ней сидел».

5. Обвинение в нарушении прав личности.

Преподавание эволюции в школах некоторые воспринимают как покушение на религиозную свободу. Сторонники этой позиции выступают за размещение в учебниках специальных предупреждений (дисклеймеров), призывающих скептически относиться к материалам, посвященным эволюции. Кроме того, противники эволюции считают необходимым преподавание в школах «альтернативного» взгляда на историю развития живых существ, под которыми подразумеваются различные версии креационизма, причем обосновывается это необходимостью «честного» и «сбалансированного» обучения. Федеральные суды уже неоднократно отвергали подобные требования как противоречащие Конституции.

Например, федеральный суд в Атланте, штат Джорджия, недавно постановил, что предупреждающие наклейки в учебниках биологии, использующихся в школах округа Кобб (рис. 9.3), противоречат пункту Первой поправки к Конституции США, которая гласит: «Конгресс не принимает законов, относящихся к установлению религии либо запрещающих свободное ее исповедание» и регулируется в соответствии с Четырнадцатой поправкой к Конституции. Это решение суда основано на многочисленных прецедентах, когда Верховный суд или федеральные суды отвергали антиэволюционные акты, методы или заявления, а также законопроекты, имеющие целью «сбалансировать» обучение.

Рис. 9.3. Наклейка на учебнике биологии для школ округа Кобб в Джорджии. Наклейки были удалены по решению федерального судьи Клеренса Купера от 13 января 2005 г. Текст наклейки:

В данном учебнике содержится информация об эволюции. Эволюция — не факт, а теория, касающаяся происхождения живых организмов. Данный материал следует воспринимать открыто, взвешенно и критически. Одобрено Советом по вопросам образования округа Кобб, вторник, 28 марта 2002 г.

В частности, судья посчитал, что утверждение «эволюция — не факт, а теория, касающаяся происхождения живых организмов» противоречит поправке к Конституции, запрещающей Конгрессу вмешиваться в религиозные вопросы. Судья писал, что эта наклейка «запутывает учащихся в отношении значения и ценности теории эволюции в научном сообществе в интересах альтернативных религиозных теорий» и призывает только материал об эволюции «воспринимать открыто, взвешенно и критически, но не объясняет, почему только к этой теории нужно относиться подобным образом» [курсив автора].

Несмотря на множество судебных прецедентов, руководство школьных округов во многих штатах всерьез рассматривает возможность «сбалансированного» обучения и других изменений, которые противоречат конституции.

6. Несовместимость с ключевыми принципами.

Главный источник конфликта по поводу теории эволюции тот же, о котором мы говорили, когда обсуждали гонения на генетиков в Советском Союзе и непризнание пользы вакцинации консервативными хиропрактиками. Он заключается в том, что эволюция не согласуется с постулатами веры, которые нельзя проверить с помощью научных методов. Как гласит организационный принцип общества «Ответы в Книге Бытия», «ответ заключается в Библии — достоверном откровении Господа, хранящем всю целостность его евангельского послания».

Дэвид Клауд из Баптистского информационного центра «Образ жизни» (Way of Life) считает, что существует три причины для отрицания эволюции.

1. «Во-первых, мы должны отбросить идею эволюции, поскольку она отрицает Библию», особенно Книгу Бытия. Клауд полагает, что «если Библию не следует понимать буквально, то у нас вообще нет способа узнать, как ее следует понимать».

2. «Мы должны отбросить идею эволюции, поскольку она отвергает Бога». «Библейский Бог вовлечен в каждый элемент творения», а «бог эволюции — это не библейский Бог».

3. «Мы должны отбросить идею эволюции, поскольку она отрицает спасение». «Если первые три стиха в Книге Бытия не являются истиной, то все остальное содержание Библии и учение о Христе и спасении — волшебная сказка, поскольку они строятся на предположении, что в их основе лежат реальные исторические события».

Мне кажется, что я честно отразил комплекс идей и убеждений большинства противников эволюции. Многие активные представители этого направления выдвигают подобные доводы. Кен Хэм считает, что «пока наша нация не позволит Богу быть абсолютным авторитетом и не примет Библию как истину», нас будут преследовать самые разные трудности.

Но, хотя наиболее красноречивые и политически активные оппоненты эволюции говорят о том, что она абсолютно несовместима с христианским мировоззрением, а популярная пресса способствует еще большему распространению этой точки зрения, она является ошибочной. С выводом о несовместимости идей христианства и теории эволюции не согласны многие ученые, теологи, духовенство и даже целые христианские конфессии.

Приведу в качестве примера высказывание епископа Оксфордского преподобного Ричарда Харриса. В радиопередаче Би-би-си «Мысли дня» он выразил свое разочарование и обеспокоенность по поводу отношения к проблеме эволюции.

Неужели некоторые люди действительно думают, что мировое научное сообщество вовлечено в массовый сговор, чтобы обмануть остальных? […] Теория эволюции не расшатывает устои веры, а углубляет их. Это быстро понял последний архиепископ Кентерберийский Фредерик Темпл, который сказал, что Бог не просто создал мир, он сделал что-то еще более замечательное — он научил мир творить самого себя. […] Вторая причина, которая меня беспокоит в связи с попытками противопоставить Книгу Бытия научной истине, заключается в том, что в результате люди перестают воспринимать Библию всерьез. Библия — это сборник книг, составленных из самого разного рода литературных трудов, поэзии, истории, этики, законов, мифов, теологии, мудрых пословиц и т. д. […] Библия открывает нам ценнейшие и важнейшие истины о том, кто мы такие и кем мы можем стать. Но буквальное восприятие Библии мешает людям видеть и отвечать на эти истины… Буквальное восприятие Библии создает плохую славу не только Библии, но и самому христианству.

Епископ не одинок в своих взглядах. На Генеральной ассамблее пресвитерианской церкви в 2002 г. вновь было заявлено, что «между эволюционной теорией происхождения человека и идеей о Боге-творце нет противоречия». В 1992 году синод Объединенной церкви Христа указывал, что «предположение о том, что в Библии содержатся научные данные о происхождении жизни, является ошибочным прочтением текстов, созданных в донаучную эпоху».

Таким образом, позиция протестантских фундаменталистов, которые настаивают на неприятии эволюции и буквальной истинности Библии во всех вопросах, включая науку, не согласуется не только с 200-летним научным опытом, но и с классической доктриной и идеологией католической, иудейской и многих протестантских церквей. Более того, такая позиция игнорирует тот факт, что многие ученые также придерживаются общепринятых религиозных взглядов.

Основным оружием противников эволюции были риторика и пропаганда, о которых я говорил выше, а также идея о том, что теория эволюции не совместима ни с какими конфессиями. Далее оппоненты эволюции попытались оказать влияние на политические процессы на местном уровне, на уровне штата и федеральном уровне. Учитывая, что все эти люди имеют откровенно религиозные цели и принадлежат к религиозным организациям, сделать это достаточно трудно благодаря Первой поправке американской Конституции. Это препятствие породило новую стратегию: появились попытки обернуть религиозное мировоззрение в шкуру научной достоверности.

Старое вино в новой бутылке: миф о разумном замысле

Новейшим воплощением «альтернативы» дарвиновской теории эволюции стала концепция разумного замысла. В соответствии с основным постулатом этой концепции некоторые биологические структуры имеют слишком сложное строение, чтобы возникнуть в результате постепенной эволюции под действием естественного отбора и, следовательно, должны были быть «задуманы» Разумным Творцом. Кто же он такой? Сторонники этой версии не любят громко называть Его или Ее имя, но если вы решили, что это Бог, то вы верно поняли идею.

Концепция разумного замысла восходит к трудам Уильяма Пейли, который 200 лет назад в «Естественной теологии» сформулировал ее основную идею. В двух словах она такова: если при виде сложных предметов, созданных руками человека, мы подразумеваем существование творца, это верно и в случае хитроумных изобретений Природы.

Интересно, что один из признанных апологетов разумного замысла, Майкл Бехе, признает древнее происхождение Земли, образование видов от общих предшественников и появление некоторых признаков под действием естественного отбора. При этом он утверждает, что некоторые структуры и системы организмов «несократимо сложны» и предположительно теряют функциональность, если удалить любую их часть. Эти системы и структуры, по мнению Бехе, не могли появиться в результате естественного отбора.

Поскольку Бехе согласен со многими биологическими фактами, он оказывается в непростом положении при попытке объяснить, как и откуда взялся разумный замысел. Представленные в этой книге данные о взаимодействии мутаций и отбора при участии временного фактора очевидным образом свидетельствуют против утверждений Бехе. В книге «Черный ящик Дарвина» (Darwin’s Black Box) Бехе пишет: «Предположим, что около 4 млрд лет назад Творец создал первую клетку, уже содержавшую все несократимо сложные биохимические системы, которые мы обсуждаем здесь, а также многие другие. (Можно постулировать, что проект систем, которые стали использоваться позднее, таких как система свертывания крови, уже существовал, но не был „включен“. В современных организмах множество генов оказались выключенными, иногда на множество поколений, чтобы включиться позднее)».

Это абсолютная бессмыслица, противоречащая основам генетики. Кен Миллер из Университета Брауна (Род-Айленд) описывает данный сценарий как «совершенно безнадежную генетическую фантазию о „преформированных“ генах, ожидающих появления подходящего организма, который стал бы в них нуждаться для своего развития». Как мы видели в главе 5, код ДНК существует по жесткому правилу: используй, или потеряешь. Постоянное воздействие мутаций приводит текст неиспользуемых генов в негодность, как это произошло с генами ледяной рыбы, человека и практически всех других организмов. Не существует механизма, который защищал бы гены до тех пор, пока они не будут востребованы. С другой стороны, мы видели (глава 4), что удвоение генов — наблюдаемый природный процесс — это один из способов расширения генетической информации и усложнения организмов в ходе эволюции, и в летописи ДНК есть множество следов удвоения генов.

В качестве примера давайте рассмотрим распределение у разных видов генов β-глобина, которые кодируют одну из двух цепей молекулы гемоглобина. У человека обнаружено пять таких генов, которые расположены рядом на хромосоме 11. В разные периоды жизни человека экспрессируются разные гены: так называемый эпсилон (ε) ген активен в период эмбрионального развития, два гамма (γ) гена функционируют на более поздних этапах развития плода, дельта (δ) глобин в незначительной степени экспрессируется в организме взрослого человека, а (β-глобин является основным глобином в составе гемоглобина взрослого. У кур имеется четыре гена β-глобина, у большинства рыб также обнаружено несколько генов β-глобина, которые организованы иначе, чем у птиц и людей, и только у ледяных рыб вовсе нет функциональных генов β-глобина.

Чем объясняется такое распределение генов β-глобинов у разных организмов? В рамках модели разумного замысла все используемые нами гены должны были быть созданы задолго до того, как возник человек и другие млекопитающие. Если это так, то почему у каких-то групп позвоночных генов β-глобинов меньше, чем у нас, а у каких-то (а именно у ледяных рыб, наиболее молодой группы рыб) их нет вообще? Ведь в соответствии с данной моделью эти заранее сформированные гены должны были сохраняться во всех видах, ожидая того момента, когда в них возникнет необходимость. И как появилась на свет ледяная рыба, у которой нет генов β-глобина, но лишь фрагмент гена α-глобина? Какой же создатель станет создавать незаконченные и нефункциональные гены?

Эволюционное объяснение картины распределения генов β-глобина гораздо проще. Предшественники позвоночных животных имели меньшее количество генов глобина, организованных примерно как у рыб. В результате удвоения этих генов с последующей дивергенцией в результате мутаций возник целый набор генов, используемых на разных этапах жизни. То же самое происходило в ходе эволюции с сотнями семейств генов.

Сторонники разумного замысла жалуются на то, что их концепция не приживается в научном сообществе из-за предубеждений. Но это не так. Ученые любят новые гипотезы, но предпочитают те из них, которые основываются на подтвержденных фактах. Именно по этой причине концепция разумного замысла не может подняться до уровня теории. Она не дает ответа ни на один вопрос, поставленный наукой, и не соответствует проверенным научным данным. Если бы не религиозный аспект и не тактика сторонников разумного замысла, мы бы и слыхом не слыхивали о нем — он почил бы с миром вместе с множеством других отвергнутых идей.

Таким образом, разумный замысел — это в лучшем случае миф. Существует множество мифов о создании и устройстве мира. Лично мне особенно нравится мифология австралийских аборигенов. Их миф о «Времени сна» и великолепная наскальная живопись являются замечательными элементами их культуры. Но миф о «Времени сна» — это не наука, он не входит в программу обучения естественным наукам, как и прочие мифы о происхождении природных явлений, и уж точно не преподносится как альтернатива настоящей науке.

К счастью, федеральный суд США согласен с таким положением дел. В наиболее важном на сегодняшний день судебном процессе по поводу концепции разумного замысла судья окружного суда Центральной Пенсильвании Джон И. Джонс III 20 декабря 2005 г. постановил, что руководство школьного округа Довер, Пенсильвания, нарушило Конституцию США, представив концепцию разумного замысла в качестве альтернативы эволюционной теории. Судья безжалостно препарировал концепцию разумного замысла и обнаружил обилие доказательств в пользу того, что разумный замысел «является религиозным воззрением, другой версией креационизма, а вовсе не научной теорией» и что этой концепции «нет места в курсе обучения естественным наукам». Судья Джонс также подчеркнул, что «многие активные сторонники [разумного замысла] исходят из ошибочного утверждения… что эволюционная теория противоречит идее о существовании высшего существа и религии в целом».

В конце 2004 г. руководство школьного округа Грантсбурга в Висконсине (моем родном штате), вдохновленное идеей разумного замысла, рассматривало вопрос о преподавании в школах «альтернативных теорий» происхождения жизни. Руководство округа получило письмо, подписанное несколькими сотнями ученых, с призывом отказаться от этого курса. Затем пришло аналогичное письмо от преподавателей теологии. Но самым убедительным оказалось третье письмо (и это вселяет определенную надежду), подписанное 188 священниками из баптистских, католических, лютеранских, методистских, епископальных и других церквей штата (позднее к ним присоединилось более 10 тыс. священников со всей страны). Я даю им заключительное слово в этой дискуссии. Вот фрагмент письма: «Мы считаем, что теория эволюции — это основополагающая научная истина, которая выдержала тщательную проверку и стала основой многих знаний и достижений человека. Пытаться отбросить эту истину или поставить ее в ряд с „другими подобными теориями“ означает признаться в научной безграмотности и передать эту безграмотность нашим детям».

Аминь.

Почему эволюция так важна?

Понимание и признание эволюции означает признание огромной роли науки в целом в развитии сельского хозяйства, медицины и технологии. Анализ ДНК не только расширяет наши возможности в области судебной медицины и установлении отцовства, диагностике, предотвращении и лечении заболеваний, но еще и помогает разобраться в реальной истории жизни вообще и человека в частности. Подобно тому как основы палеонтологии подкрепляются обширным объемом геологических данных, так и эти новые знания об эволюции, полученные в ходе изучения летописи ДНК, подкрепляются многочисленными данными клеточной и молекулярной биологии, генетики, эмбриологии и физиологии.

Случалось, что новые открытия в астрономии, микробиологии и генетике не находили понимания в определенных кругах до тех пор, пока не накапливалось большого количества материальных, зримых доказательств. Материальных доказательств эволюции в последовательностях ДНК уже предостаточно, и отрицать их невозможно. Тем же, кто подобно французским докторам позапрошлого века, диктаторам от советской биологии или консервативным хиропрактикам продолжает отвергать эволюцию при наличии всех этих данных, нельзя позволять утаивать или игнорировать научные факты в своих интересах.

Как показывает история, когда прогресс в науке останавливается, жизнь людей резко, если не катастрофически, ухудшается. В следующей — и заключительной — главе я остановлюсь на том, как важно понимать роль эволюции и научного прогресса в целом, чтобы нести ответственность за судьбу всей планеты.

Отпечаток пальмового листа и рыб эпохи эоцена (примерно 50 млн лет назад) из национального заповедника Фоссил-Бьютт на юго-западе штата Вайоминг Фотография любезно предоставлена Ширли Ульрих, галерея Ульриха, Кеммерер, Вайоминг.

Глава 10 Пальмы Вайоминга

Чем дальше вы заглядываете в прошлое, тем больше можете увидеть в будущем.

Уинстон Черчилль

«Величайшее чудо девятнадцатого столетия!» — заявлял иллюстрированный справочник The Pacific Tourist в 1876 г.

Строительство трансконтинентальной железной дороги началось вскоре после окончания Гражданской войны в Америке. Две конкурирующие компании — Central Pacific и Union Pacific — продвигались навстречу друг другу с запада и с востока с бешеной скоростью и наконец 10 мая 1869 г. встретились в городке Промонтори в штате Юта. Так было закончено строительство дороги, которое обошлось по тем временам в гигантскую сумму свыше 120 млн долларов.

Это великое достижение стало результатом героических усилий рабочих, которые укладывали рельсы буквально голыми руками. Одна только компания Union Pacific использовала 300 тыс. тонн железных рельсов и свыше 23 млн путевых костылей. Эта работа не просто требовала невероятных физических усилий (12-часовой рабочий день на жаре), она была чрезвычайно опасной. Случайные взрывы пороха и нитроглицерина, обрушение скал и постоянные нападения местных индейцев, которые поняли, что строительство железной дороги разрушит привычный уклад их жизни, — все это усложняло работу.

Рис. 10.1. «Разрез окаменелых рыб» трансконтинентальной железной дороги. В горных породах этих мест содержится множество окаменелостей, относящихся к эпохе эоцена. Фотография Эндрю Джозефа Рассела (1869), любезно предоставленная музеем Sweetwater Country в Вайоминге.


Но вместе с тем было и ощущение величия замысла, и дух приключения — предстояло открыть и покорить огромные, неведомые, малонаселенные земли американского Запада. Там, к западу от Омахи, лежали Черные Холмы, бассейн Вайоминга, хребет Уосатч и другие удивительные места.

В 1868 году два служащих Union Pacific, А. Хиллиард и Л. Риксикер, наблюдали за ходом работ примерно в 3 км к западу от реки Грин-Ривер в штате Вайоминг (тогда это была территория Дакоты). Здесь при взрывах типичной для этих мест пустой породы в кусках сланца было обнаружено невероятное количество прекрасно сохранившихся ископаемых остатков рыб и растений. Как выяснилось потом, эти окаменелости были частью одного из самых крупных и хорошо сохранившихся на Земле местонахождений ископаемых остатков.

Так величайшее чудо XIX столетия совпало с величайшим чудом эпохи эоцена, начавшейся примерно 500 тыс. столетий назад.

Рабочие передали свои находки Фердинанду В. Гайдену, представлявшему на этой территории Министерство внутренних дел США. Гайден, врач по образованию, когда-то заметил: «Моя любовь к естественной истории настолько сильна, что я вряд ли могу испытывать интерес к чему-либо еще». Индейцы племени сиу хорошо его знали, дали ему прозвище «Тот, Кто Собирает Камни На Бегу» и, по-видимому, считали человеком странным, но безобидным. После сделанного железнодорожными рабочими открытия Гайден опубликовал первое описание богатых отложений в районе Грин-Ривер. Но это не единственная заслуга Гайдена. В 1869 году он нашел первые на территории Америки остатки динозавра, и его исследования способствовали созданию Национального парка в Йеллоустоне в 1872 г.

«Ископаемые рыбы» оказались частью большого отложения, образовавшегося на дне бывшего озера. Кроме остатков различных видов сельдевых рыб, число которых достигает нескольких сотен на один квадратный ярд[28] (рис. 10.2), здесь были обнаружены изумительные останки скатов, веслоносов и панцирников, а также крокодилов, черепах, птиц, летучих мышей и мелких лошадей.

Рис. 10.2. Большое кладбище рыб. Массовое «захоронение» животных сохранилось в виде единого отложения в каменной плите из района Фоссил-Бьютт. Фотография Джейми Кэрролл; плита из галереи Ульриха, Кеммерер, Вайоминг.


А еще тут были изумительные пальмы размером до 3 м, сохранившиеся в мельчайших деталях.

Гайден сделал логичный вывод, что те места, где теперь простирается плоская пустыня с бесплодной землей, когда-то были покрыты буйными тропическими лесами, а по климату и растительности напоминали современные юго-восточные районы США. Богатые слои осадочных пород образовались примерно от 40 млн до 50 млн лет назад и теперь проходят по долинам юго-западной части штата Вайоминг. В нескольких слоях (называемых горизонтами) толщиной от 50 до 100 м в большом количестве сохранились удивительные окаменелости. Если вам когда-нибудь доводилось видеть хорошо сохранившиеся образцы ископаемых рыб на светлом желтоватом камне, с большой вероятностью они происходят из отложений в районе Грин-Ривер. Часть этого большого отложения в 1972 г. была объявлена национальным памятником Фоссил-Бьютт.

Особенностью этого отложения является исключительная красота и сохранность образцов, а также невероятный контраст между природной средой, которую они представляют, и сегодняшним пейзажем этих мест. Окаменевшие пальмы и крокодилы напоминают нам о том, как сильно меняются природные условия в любой точке Земли с течением времени, и о том, что одни виды исчезают и сменяются другими. Все это заставляет еще раз вспомнить, что «наиболее приспособленный» — это временный и весьма условный статус.

Рис. 10.3. Ландшафт национального памятника Фоссил-Бьютт. Там, где когда-то простирались буйные тропические леса, теперь остались только бесплодные земли и изъеденные ветрами камни. Фотография любезно предоставлена Арвидом Эйзом, Служба национальных парков США.


Озеро, в котором были обнаружены ископаемые, было самым маленьким из трех озер, когда-то располагавшихся на территории современного Вайоминга, Колорадо и Юты. Оно имело длину 80 км и ширину 30 км в самой широкой части и просуществовало около 2 млн лет, а это долгий срок для большинства озер, но значительные изменения климата в конечном итоге привели к его исчезновению. Эти климатические изменения самым серьезным образом повлияли на условия отбора и на флору и фауну этих мест.

До этого момента я рассказывал главным образом о том, как формировались наиболее приспособленные. В этой заключительной главе я хочу рассказать, как они расформировывались, то есть вымирали. В истории живой природы было множество существ, которые когда-то встречались в изобилии (трилобиты, динозавры, аммониты и многие другие), но по естественным причинам полностью исчезли. Я хочу поговорить и том, как деятельность человека способствовала и продолжает способствовать гораздо более быстрому исчезновению ранее многочисленных видов. Этот «неестественный» отбор при участии человека привел ко многим неожиданным последствиям. В частности, я расскажу о состоянии мирового рыбного промысла, которой серьезно страдает от неограниченного лова рыбы, ухудшения состояния окружающей среды и изменений климата.

Почти 50 лет назад биолог-эволюционист Джулиан Хаксли, внук известного биолога и главного сторонника Дарвина Томаса Хаксли и брат писателя Олдоса Хаксли, в книге «Новые бутылки для нового вина» (New Bottles for New Wine) писал: «Как будто человека назначили управляющим директором самого большого предприятия, эволюции… и вне зависимости оттого, понимает ли он, что делает или нет, он определяет будущее направление эволюции на этой планете. Это его неизбежная судьба, и чем скорее он поймет и поверит в нее, тем лучше будет для всех».

Отрицание или непонимание нашего влияния на ход эволюции в сочетании с преследованием личных интересов уже привело к исчезновению некоторых экономически значимых видов животных, а также к изменению образа жизни сотен тысяч людей, связанных с этими животными. Серьезнейшая опасность нависла над многими другими видами, которые испытывают чрезвычайно сильное влияние человека, адаптироваться к которому не в состоянии ни одна популяция. Давайте осознаем наконец, что понимание сути эволюции не только имеет эстетическое или философское значение, но и лежит в основе разумной экономической политики.

Неестественный отбор

Снежный баран, наверное, является самым величественным символом высокогорья Вайоминга и соседних областей. Туристы мечтают хотя бы мельком увидеть это пугливое животное, а для охотников это редкий трофей, равных которому среди легально добытых трофеев найдется немного. Продажа охотничьих лицензий на аукционах принесла доход в несколько сотен тысяч долларов. Эти доходы пошли на поддержание необходимых охранных мер, и какое-то время считалось, что забой нескольких особей компенсируется общим положительным результатом для всей дикой природы края.

Однако долгосрочные исследования выявили неожиданные серьезные последствия этой избирательной охоты за трофеями. Охотникам больше по душе бараны с самыми крупными рогами. К сожалению, то же самое можно сказать о самках снежных баранов. Наиболее интенсивный рост рогов у этих животных происходит в возрасте от двух до четырех лет. Преимущество в спаривании получают бараны старше шести лет, находящиеся на верхушке иерархической лестницы и имеющие самые длинные рога. Однако большинство баранов отстреливают в возрасте до восьми лет, а иногда и в четыре года.

Рис. 10.4. Снежный баран. При выборе партнера самки ориентируются на длину рогов и массу тела самца. Фотография Дона Гетти.


На протяжении 30 лет в одном из районов Канадских Скалистых гор отмечалось значительное снижение «качества породы» баранов, выражавшееся в уменьшении среднего размера рогов и средней массы тела. Эти признаки в значительной степени передаются по наследству. Отстрел более крупных животных стал фактором отбора, способствующим снижению скорости роста и увеличению доли более мелких животных с более короткими рогами. Внешний вид животных и их генетическое содержание в своей эволюции отклонились от оптимума. Это еще один пример действия математики эволюции (сочетание изменчивости и отбора во времени), но только в неправильном направлении.

Эволюция данной популяции снежных баранов показывает, что отбор человеком определенных признаков может уводить эволюцию в противоположную сторону оттого направления, которого хотел добиться сам человек и которое является оптимальным в естественных условиях. В этом состоит одна из важнейших проблем, связанных с управлением многими природными ресурсами, особенно рыбными. Без учета законов эволюции, основанных на научных данных, такие трагические эпизоды, как тот, о котором я сейчас расскажу, будут повторяться и приводить к необратимым катастрофическим последствиям.

Мыс без трески

Одним из важнейших препятствий на пути развития мореплавания была проблема обеспечения моряков продовольствием. Чтобы плавать на дальние расстояния, нужно было найти способы сохранения продуктов. Изобретение методов высушивания и засолки трески позволило увеличить дальность плавания и способствовало открытию Гренландии, Исландии и Северной Америки. В 1497 году Джон Кабот (урожденный Джованни Кабото) отправился на поиски морского пути в Азию, которого не нашел Колумб. Вместо Азии Кабот обнаружил место, которое счел идеальным для засолки и сушки рыбы, и назвал его Ньюфаундлендом (буквально «новая найденная земля»). Вскоре к этому, как казалось, неиссякаемому источнику рыбы стали стекаться суда всех европейских держав, и всего через 40 лет 60 % всей рыбы попадало на европейские столы из прибрежных вод Северной Атлантики.

Рис. 10.5. Атлантическая треска. Когда-то трески в Атлантике было столько, что капитаны жаловались, что рыба мешает проходу судов. Однако в результате избыточного промысла популяция северной трески практически исчезла.


В 1602 году англичанин Бартоломью Госнольд открыл место, названное им Паллавичино, где было невероятно много трески (теперь это место носит название Кейп-Код)[29]. Ловля трески стала важным элементом жизни новых колонистов. В таких городах, как Глостер на мысе Кейп-Энн, штат Массачусетс, рыбная ловля стала основной сферой деятельности. В XIX веке 3800 мужчин из Глостера погибли в море, притом что все население города составляло около 15 тыс. человек.

Второго июля 1992 г., через 500 лет после начала активного рыбного промысла, Канада наложила мораторий на ловлю трески в этих местах в связи с практически полным исчезновением популяции этой рыбы. Популяция северной трески сократилась на 99,9 % по сравнению с показателями 1960-х гг. Около 20 тыс. канадских моряков потеряли работу.

Рыбаков Глостера ожидала та же участь. За пару десятков лет улов сократился в несколько раз. Федеральное правительство начало скупать рыболовецкие суда, чтобы помочь рыбакам изменить традиционный образ жизни, а часть рыбных производств была закрыта, чтобы популяция рыбы смогла восстановиться.

Но популяция трески не восстановилась.

Что же произошло?

Не вдаваясь в подробности, можно сказать, что треска и занятые ловлей трески рыбаки стали жертвой универсального закона, связывающего изменчивость и отбор. Рыбаки вылавливали более крупных (и более взрослых) рыб. В результате рыба, которая благодаря генетическому складу имела тенденцию достигать большего размера и доживать до более взрослого возраста, отлавливалась до момента воспроизведения. Удаление из популяции таких экземпляров привело к увеличению доли более мелких рыб. При избыточном рыбном промысле и сокращении численности популяции треска стала достигать зрелости в более раннем возрасте и при меньшем размере.

Казалось бы, если рыба достигает зрелости быстрее, то и популяция должна быстрее увеличиваться. Возможно, это было бы так в пруду, но не в океане, где есть и другие обитатели. Там, где когда-то треска была доминирующим хищником, питавшимся ракообразными и пелагическими видами рыб, теперь значительно увеличилась популяция именно этих животных. Те животные, которые раньше становились добычей трески, теперь сами стали питаться треской, поедая ее икру и личинок, что препятствовало восстановлению популяции трески. Вспомните, что «наиболее приспособленный» — это тот, кто отличается наилучшей способностью к воспроизведению и выживанию. Мелкая треска плохо приспособлена к жизни в экосистеме, перевернутой с ног на голову. Это последствие избыточного промысла и нарушения экологического равновесия коснулось не только трески, но и многих других хищных морских рыб.

Куда исчезла крупная рыба?

Кроме трески к крупной морской рыбе можно отнести тунца, рыбу-меч, марлинов, акул, а также многих «придонных» рыб, таких как камбала, палтус и скат. Многие из них являются важными промысловыми видами, а некоторые тунцы считаются одними из наиболее ценных деликатесов.

После Второй мировой войны промысел этих рыб был организован в промышленных масштабах, и в погоню за крупной рыбой вышли крупные траулеры. На основании анализа большого количества данных за период с 1952 по 1999 г. биологи Рэнсом Майерс и Борис Уорм из Университета Далхаузи в Галифаксе (Новая Шотландия) пришли к выводу, что численность крупных хищных рыб сократилась в десять раз по сравнению с их численностью до начала индустриального промысла.

Майерс и Уорм обнаружили одну и ту же тенденцию на четырех континентальных шельфах и в девяти океанических системах: за первые 15 лет интенсивного промысла численность рыб сократилась на 80 % (рис. 10.6).

Рис. 10.6. Сокращение популяции крупных морских рыб. Численность крупных рыб сократилась как в Атлантическом (а), так и в Тихом (б) океанах (по результатам ярусного лова). Ситуация с акулой-молотом (в) является типичной для большинства видов акул. Рисунок Лианн Олдс на основании данных R. Mayers and B. Worm (2003), Nature 423:280 и J. K. Baumetal (2003), Science 299:389.


При лове ярусами улов снизился от 6–12 рыб на 100 крючков до 0,5–2 рыб на 100 крючков за первые десять лет интенсивного промысла. Кроме того, сократилась не только численность вылавливаемой рыбы, но и ее размер. Майерс отмечает, что «средний размер этих хищников, находящихся на вершине пищевой цепи, составляет от одной пятой до одной второй их былого размера. Вес лишь немногих голубых марлинов достигает одной пятой прежнего веса этих рыб. Во многих случаях современные промысловые рыбы находятся под таким сильным давлением, что у них просто нет возможности для воспроизводства».

Майерс очень много сил потратил на то, чтобы изменить отношение людей к морю как к неисчерпаемому ресурсу и показать, что многие морские виды находятся на грани исчезновения. В 1883 году даже Томас Хаксли предполагал, что запасы рыбы на Земле безграничны. Майерс пишет, что причиной такой точки зрения «было кажущееся неисчерпаемое изобилие морских видов, труднодоступность многих морских уголков и плодовитость морских рыб. Оказалось, что все эти аргументы ошибочны».

Людей обычно мало волнует жизнь акул-молотов или белых акул, но еще одно исследование (соавторами которого были Майерс и Уорм) показало, что за последние 15 лет популяция этих рыб сократилась на 75 %, а популяция всех акул в целом — на 50 %. До некоторой степени сокращение численности этих видов связано с так называемым приловом, когда рыба попадается на крючки или в сети, предназначенные для ловли других видов рыб. Акулы, находящиеся на вершине пищевой цепи, играют важную роль в функционировании всех пищевых цепей и экосистем океана. Поэтому снижение численности акул изменяет условия отбора в экосистемах, что приводит к непредвиденным последствиям.

Лов тралом влияет на другой аспект отбора, а именно на размер рыб. Например, установленный размер ячеек рыболовных сетей на промышленных траулерах в последние десятилетия составлял от 7 до 14 см. Это означает, что некоторые виды рыб неизбежно попадают в сети, тогда как другие проскальзывают сквозь них. Влияние подобного отбора на размер североатлантических скатов хорошо задокументировано.

За несколько последних десятилетий увеличилась численность популяций двух мелких видов скатов, звездчатого и гладкохвостого. А вот острорылые скаты, достигающие 1 м в ширину во взрослом возрасте и 20 см при рождении, находятся на грани исчезновения. Никто не задумывался о численности острорылых скатов, пока Джилл Кейси из Мемориального университета Ньюфаундленда и Рэнсом Майерс не обратили внимания на то, что за последние 20 лет в водах южнее Ньюфаундленда не было выловлено ни одной рыбы этого вида. Сорок пять лет назад острорылые скаты составляли до 10 % всего улова. В последнее время этих скатов встречали только на глубине 1000 м во время поиска мест для ловли палтуса.

Вымирание крупных хищных рыб или селективное исчезновение других крупных рыб нельзя рассматривать просто как исчезновение отдельных видов животных. Этот процесс помогает осознать последствия избыточного промысла и неумышленного лова для экосистем, в которых эти виды живут (или жили).

Эффект домино

В прибрежных зонах океанов и морей встречаются различные экосистемы, такие как коралловые рифы, заросли бурых водорослей или морской травы, а также эстуарии. В каждом из этих сообществ существуют организмы, которые играют важнейшую роль в их строении и разнообразии, и все их члены соединены сложной сетью взаимоотношений. Избыточный лов рыбы и другая деятельность человека разрушают эти взаимосвязи, что нередко приводит к катастрофическим последствиям.

К примеру, заросли бурых водорослей служат пристанищем для многих рыб, беспозвоночных животных и некоторых млекопитающих, таких как морские выдры. Водорослями питаются морские ежи, которые в свою очередь служат пищей для выдр и придонных рыб, включая треску. В тех местах, где из-за избыточного лова была истреблена вся треска или в результате охоты пропали все выдры, морские ежи начинают активно размножаться и полностью уничтожают все водоросли. Это так называемый эффект домино, являющийся следствием исчезновения животных, находящихся на вершине пищевой цепи. Если отловить морских ежей, то водоросли вернутся, но, поскольку отсутствуют другие члены сообщества, экосистема останется навсегда обедненной.

В коралловых рифах тоже живут самые разные виды рыб и беспозвоночных, которые в свою очередь служат пищей для более крупных животных. Морская звезда «терновый венец» питается кораллами, а численность их самих, по-видимому, контролируется определенными видами рыб. В 1980-х годах массовый всплеск численности этих морских звезд на Большом Барьерном рифе привел к уничтожению значительной части рифа и лишил многих животных их естественной среды обитания.

Аналогичным образом состояние морской травы, покрывающей дно заливов, лагун и других прибрежных областей, зависит от численности питающихся ею животных, а эти животные в свою очередь зависят от обилия травы. Морской травой питаются морские черепахи, за счет чего питательные вещества попадают в пищевую цепь, а не осаждаются в виде донных отложений. Однако во многих местах популяции черепах значительно сократились или были полностью уничтожены, что способствовало вымиранию морской травы.

Дюгонь — еще один любитель морской травы. В конце XIX в. австралийские поселенцы видели большие стада дюгоней в заливе Моретон в Квинсленде. Эти стада длиной в 5–6 км насчитывали десятки тысяч особей, но с тех пор сократились до всего 500 особей. Охота за мясом и жиром этих животных очень быстро привела к их почти полному уничтожению.

Джереми Джексон из Океанографического института Скриппса в Ла-Джолле, Калифорния, и 18 его коллег провели анализ изменений экосистем прибрежных зон от зарождения цивилизации приблизительно 10 тыс. лет назад до нашего времени. Они обнаружили, что вырождение экосистем во всем мире происходило в три этапа. Сначала местные племена использовали прибрежные зоны в ограниченном масштабе. Затем, в период европейской экспансии и возникновения колониальной системы, нагрузка на шельфовую зону увеличилась. И наконец, наиболее быстрое истощение ресурсов этой зоны произошло в последние годы. В качестве точки отсчета для регистрации современных изменений популяций животных принято использовать показатели 1950-х и 1960-х гг., однако сами эти показатели составляют лишь долю численности живых существ, населявших шельф до начала его использования человеком.

Джексон и его коллеги обеспокоены тем, что «лишь немногие современные исследователи принимают во внимание исходное природное изобилие крупных морских позвоночных», и напоминают нам, что многие места на Земле (острова, города, заливы и т. д.) названы в память о тех животных, которые стали очень редкими или исчезли навсегда. Когда в районах гнездования вы видите десятки тысяч морских черепах, кажется, что их невообразимо много, но представьте себе, что всего несколько столетий назад эти популяции насчитывали десятки миллионов особей.

Идеальный шторм

Хотя избыточный лов, без сомнения, является главной причиной массового сокращения популяций морских животных, дополнительный вклад в этот процесс внес также рост численности людей и мощное развитие индустрии, начавшееся с промышленной революции. Идеальный шторм — это сочетание избыточного лова, загрязнения окружающей среды и изменения климата, вызванного антропогенным фактором. Стоит только взглянуть на состояние экосистем вблизи густонаселенных районов, и синергетическое влияние этих трех факторов станет очевидным.

Рассмотрим в качестве примера Чесапикский залив, являющийся крупнейшим в США эстуарием. В этот залив длиной около 300 км впадает свыше 150 рек и ручьев. Когда капитан Джон Смит исследовал залив в начале 1600-х гг., он обнаружил чистую поверхность воды с лужайками морской травы и с пасшимися на ней крабами, устричные рифы, такие огромные, что они мешали плыть, а также косяки морских окуней и других рыб.

Среди всех морских экосистем эстуарии умеренной зоны пострадали больше всего. Устрицы, когда-то обитавшие в Чесапикском заливе, за три дня могли профильтровать всю толщу воды. Но, когда для промышленной добычи устриц начали использовать драги, популяция этих моллюсков резко сократилась. А уничтожение видов, контролирующих структуру экологического сообщества, как мы только что убедились, вызывает серьезные последствия для всей экосистемы.

После исчезновения устриц появились первые симптомы разрушения экосистемы залива. Упало содержание кислорода в воде, стали распространяться болезни. Свою роль сыграл и второй фактор антропогенного воздействия — загрязнение окружающей среды. Поврежденная экосистема не могла контролировать изменение уровня осадконакопления, содержания питательных веществ и микробов, вызванное интенсивным развитием промышленности и сельского хозяйства. Несмотря на то что на протяжении 20 лет правительство США и частные агентства пытались принимать соответствующие меры по охране этой территории, в 2004 г. «мертвая зона» обедненной кислородом воды покрывала свыше 35 % площади залива.

Такая же картина повреждения, упадка и разрушения природной экосистемы эстуариев, когда-то населенных устрицами, наблюдается и во многих других местах. Повторение эволюционных событий, к величайшему сожалению, в такой ситуации абсолютно предсказуемо.

Теперь вдобавок к избыточному лову и загрязнению среды в силу вступает третий важный фактор давления на природные системы — изменение климата. Количественно оценить вклад изменения климата в уничтожение природных систем достаточно сложно, поскольку многие экосистемы на сегодняшний день уже оказались в плачевном состоянии. Тем не менее очевидно, что некоторые локальные изменения климата оказывают глубокое влияние на экологические сообщества. Этим сообществам теперь приходится противостоять еще одной враждебной силе.

Восстановление каждой конкретной экосистемы, пострадавшей от избыточного лова и загрязнения, — это постоянный вызов. Заниматься этим на фоне дальнейших глобальных изменений еще труднее. По сравнению с Атлантическим и Тихим океанами, окруженными большими человеческими популяциями и опустошенными рыболовством, может показаться, что последние убежища для морского биоразнообразия — просторы Южного океана и ненаселенная Антарктика. К сожалению, это не так. История, приведшая к исчезновению трески, меч-рыбы, марлина, дюгоней, устриц, черепах, морских выдр и многих других северных животных, повторяется и на юге.

Возвращаемся на остров Буве

Основной причиной, по которой Дитлеф Рустад и Йохан Рууд оказались в Южном океане, было снижение численности китов в северных водах, отчего китобойный флот Норвегии заинтересовался поиском новых мест для промысла. Норвежцы начали охотиться на китов в антарктических водах в начале 1900-х гг.; между 1904 и 1906 гг. было поймано 236 китов. К 1912 году количество пойманных китов увеличилось до 10 760, а к 1940 г. — до 40 тыс.

По мере угасания популяций китобои переходили от лова одного вида к другому. К примеру, в 1930–1931 гг. было выловлено 29 тыс. синих китов. Затем охотники перешли к лову полосатиков, потом сейвалов, горбатых китов и малых полосатиков. К тому времени, когда большинство стран договорилось ввести мораторий на ловлю китов в водах Антарктики, численность синих китов сократилась от 200 тыс. всего до 6 тыс. особей, популяция горбатых китов снизилась в той же пропорции, а численность сейвалов и полосатиков упала до 20 % от исходного значения.

Сначала исследования Рустада были посвящены крилю — мелкому ракообразному, находящемуся в центре пищевой цепи антарктической экосистемы. По мере угасания популяции китов постепенно начал увеличиваться промышленный лов криля, начавшийся в 1972–1973 гг. Криль используют для изготовления пищевых продуктов, в качестве корма для скота и для разведения рыбы. Возможно, по численности популяции это животное занимает первое место на Земле. Гигантские стаи криля могут занимать площадь до 500 км2, а вес животных в одной стае достигает 2 млн т. В одном кубическом метре воды может содержаться 1 млн особей. Пик добычи криля пришелся на 1982 г., когда было выловлено 500 тыс. т, а сегодня составляет примерно 100 тыс. т в год. Общие запасы криля оцениваются в десятки или сотни миллионов тонн, поэтому современная скорость лова, кажется, не угрожает существованию популяции. Однако долгосрочные исследования показывают, что за последние 75 лет плотность стай криля сократилась на 80 %. Если это не результат лова, что же произошло?

Рис. 10.7. Криль (Euphasia superba). Возможно, это животное является самым многочисленным обитателем Земли; оно находится в центре пищевой цепи в антарктическом регионе. Однако плотность стай криля за последние 75 лет снизилась на 80 %.


За последние 50 лет температура воздуха в Антарктике поднялась на 2–3 °C, что в пять с лишним раз больше, чем в среднем на планете. Это повышение температуры сопровождалось уменьшением массы льдов. Криль питается водорослями, живущими на морском льду. И мы вновь наблюдаем эффект домино: глобальное потепление способствует таянию льда, что приводит к сокращению численности водорослей, а это в свою очередь является причиной сокращения численности криля.

Как вы знаете, существует вероятность, что глобальное потепление будет продолжаться, температура воздуха и воды — расти и, следовательно, океанские льды — таять. Некоторые ученые предсказывают, что в ближайшие 100 лет температура поднимется еще на 2–3 °C. В Антарктике это определенно приведет к сокращению поверхности льда, доступной для роста водорослей, и окажет влияние на популяции животных, питающихся крилем, а также животных, адаптированных к жизни в холоде.

Какая судьба ждет удивительных ледяных рыб? Возможные климатические изменения вселяют тревогу, но ледяные рыбы уже пережили одну катастрофу. Когда китобойный промысел умер, внимание рыбаков переключилось на антарктических рыб, включая ледяных. Ледяную рыбу Champsocephalus gunnari (рис. B цветной вкладки) начали ловить в 1971 г. В 1978 году улов достиг максимума и составил 235 тыс. т. А затем повторилась та же история, которую я уже описывал: в 1991 г. улов снизился до 13 тыс. т, а в 1992 г. — всего до 66 т и до прежнего уровня уже не восстановился.

Возможно, нам удалось спасти от исчезновения голубого кита (после десятилетий промедления и политических споров), но серьезного урока мы из этой истории не извлекли.

Как бы ни сложилась судьба ледяных рыб, понятно, что для восстановления популяции придется противостоять избыточному лову, разрушению экосистемы и изменению климата. Поскольку физиологические процессы в организме рыб этого вида настроены на отрицательную температуру, пока нельзя сказать, сможет ли поредевшая популяция адаптироваться к постоянному повышению температуры воды всего за сотню лет, да еще и в условиях обеднения источников питания.

Бьем в набат

Недостаток предвидения, нежелание действовать, когда действие могло бы быть простым и эффективным, отсутствие ясного мышления, путаница точек зрения до тех пор, пока ситуация не станет критической, пока инстинкт самосохранения не начнет бить в набат, — все это бесконечно повторяется в истории.

Уинстон Черчилль Выступление в Палате общин 2 мая 1935 г.

Я понимаю, что завершаю нашу послеобеденную беседу на самой пессимистической ноте. Но мне кажется, это совершенно необходимо. Я по профессии биолог, но я сам не знал многих цифр, которые привел в этой главе, пока не начал собирать материал. Скажите спасибо, что я не стал рассказывать о ситуации в дождевых лесах или каких-то других регионах.

Слова Черчилля — это наиболее подходящая цитата, которую я могу привести на прощание. Сегодня будущее природы нашей планеты выглядит очень мрачно, во многом таким же мрачным, какой Черчилль видел геополитическую ситуация в 1935 г. Черчилль осознавал угрозу фашизма, нацизма, советского коммунизма и множество раз предупреждал об этих опасностях, но его не слышали. Тогда, как и сейчас, большинство западных лидеров отрицали очевидное, принимали желаемое за действительное и слепо верили в благоприятный исход событий. Они заключали бессмысленные союзы, произносили пустые фразы и принимали умиротворенный вид, добиваясь символических результатов. После быстрого падения Франции в 1940 г. Британия под руководством Черчилля осталась в одиночестве, пока Соединенные Штаты наконец не были вынуждены вступить в войну после неожиданного нападения Японии на Перл-Харбор. Война против природы разгорается уже более 50 лет, но мало сильных сторонников встало на ее защиту.

Будет совсем непросто спасти природу от окончательной гибели, не говоря уже о том, чтобы ее восстановить. Рэнсом Майерс горестно заявляет: «Мы продолжаем все отрицать, пререкаемся о численности последних выживших, используем спутники и датчики, чтобы поймать последнюю оставшуюся рыбу. Мы должны осознать, насколько некоторые из этих популяций близки к вымиранию. Нужно действовать прямо сейчас, пока мы не достигли точки невозврата. Я хочу, чтобы на свете еще были акула-молот и синий тунец, когда вырастет мой пятилетний сын. Но если масштаб отлова останется прежним, этих прекрасных рыб постигнет участь динозавров».

Конечно, стандартный ответ на подобные высказывания заключается в привычном отрицании фактов и защите собственных интересов. Когда Майерс работал в Министерстве рыбного хозяйства и океанов, местные чиновники буквально зажимали ему рот, поскольку он не соглашался с тем, что причиной исчезновения трески была холодная вода или увеличение численности тюленей. За публичную критику деятельности министерства на Майерса даже подали в суд за клевету.

Тех, кто обеспокоен состоянием окружающей среды, часто обвиняют в порождении ложной тревоги, склонности к философствованию или эстетической сентиментальности. Но изучите факты, и вы поймете, что спор о мотивах этого беспокойства не имеет никакого смысла. Просто из любопытства ознакомьтесь с современной статистикой и данными прошлых лет. Рэнсом Майерс и Борис Уорм пишут: «Сегодняшние решения определяют, что мы будем делать через 20 или 50 лет: наслаждаться биологическим разнообразием и продолжать экономически выгодный промысел рыбы — или оглядываться назад, на историю краха и вымирания, которые вовремя не предотвратили».

И тем не менее сегодня, в начале XXI в., имея за плечами 200-летнюю историю эволюционной науки, мы все еще спорим о реальности эволюции. И, хотя уже больше двух веков мы испытываем на себе последствия избыточного лова рыбы, избыточного отстрела животных и загрязнения окружающей среды, гоняемся за немногочисленными рыбами, которым удалось выжить.

Братья Хаксли напоминают нам, что «факты не перестают существовать оттого, что ими пренебрегают» и что теперь мы «определяем будущее направление эволюции на этой земле». Обратим ли мы внимание на эти факты и признаем свою ответственность, хотя бы по той причине, что это в наших собственных интересах? Или треска, тунец, марлин, синий кит, дюгонь, ледяная рыба и многие другие животные станут такой же редкостью, как пальмы в Вайоминге?

Источники и дополнительная литература

Открытия и идеи, о которых я писал, принадлежат очень большому числу биологов. Поскольку эта книга предназначена для широкой публики, я решил не указывать прямо в тексте, кто конкретно и в какой лаборатории выполнил то или иное исследование, и не делать сносок. Вместо этого в заключительном разделе я привожу два списка литературы. Вначале я указываю несколько книг по эволюции, а затем привожу подробный перечень оригинальных научных публикаций, которыми я пользовался при написании каждой главы. В большинстве случаев название журнальной статьи опущено, поскольку указанных данных достаточно, чтобы читатель смог самостоятельно найти заинтересовавшую его работу. Фрагменты большинства статей по биологии можно найти с помощью бесплатной государственной базы данных PubMed на сайте http://www.ncbi.nlm.nih.gov/entrez/query.fcgi.

Книги об эволюции

Среди многих замечательных книг, посвященных эволюции, для читателей этой книги, возможно, наиболее интересными окажутся следующие.

Carroll, Sean. Endless Forms Most Beautiful: The New Science of Evo Devo and the Making of the Animal Kingdom. New York: W. W. Norton, 2005.

Conway Morris, Simon. Life’s Solution: Inevitable Humans in a Lonely Universe. Cambridge: Cambridge University Press, 2003.

Dawkins, Richard. The Ancestor’s Tale: A Pilgrimage to the Dawn of Evolution. New York: Houghton Mifflin, 2004.

Dawkins, Richard. The Blind Watchmaker: Why the Evidence of Evolution Reveals a Universe Without Design. New York: W. W. Norton, 1986.

Dawkins, Richard. Climbing Mount Improbable. New York: W. W. Norton, 1996.

Desmond, Adrian, and James Moore. Darwin: The Life of a Tormented Evolutionist. London: Michael Joseph, 1991.

Knoll, Andrew. Life on a Young Planet: The First Three Billion Years of Evolution on Earth. Princeton, N. J: Princeton University Press, 2003. Palumbi, Stephen. The Evolution Explosion: How Humans Cause Rapid Evolutionary Change. New York: W. W. Norton, 2001.

Ridley, Matt. The Red Queen: Sex and the Evolution of Human Nature. London: Penguin, 1993.

Weiner, Jonathan. The Beak of the Finch: A Story of Evolution in Our Time. New York: Alfred A. Knopf, 1994.

Zimmer, Carl. Evolution: The Triumph of an Idea. New York, Harper Collins, 2001.

Предисловие: вне всяких сомнений

История оправдания Кевина Ли Грина описана в докладе «Что каждый страж закона должен знать о ДНК» (National Institute of Justice, National Commission on the Future of DNA Evidence, 1999), а также в досье общественной организации «Проект невиновности» (www.innocenceproject.org). Расширенное привлечение анализа ДНК к разрешению нераскрытых дел описано в отчете Анализ ДНК в судебной медицине и патологической анатомии (Smith Ailing Lane, P. S., and Washington State University, 2003).

Информацию о новых последовательностях ДНК можно найти, в частности, в базе данных GenBank (www.ncbi.nih.gov/genbank/gen-bankstats.html).

1. Введение. Белокровная рыба с острова Буве

Описание путешествия Дитлефа Рустада на судне «Норвегия» и его фотографии приведены в докладе O. Holtedahl, ed., Scientific Results of the Norwegian Antarctic Expeditions, 1927–1928 (Oslo: I Kommisjon Hos Jacob Dybwad, 1935).

Йохан Рууд описал свое путешествие в Антарктику в Scientific American 213 (1965): 108–115. Его оригинальная статья об отсутствии эритроцитов у ледяных рыб была опубликована в Nature 173 (1954): 848–850.

Описание генов глобинов у ледяных рыб можно найти в работах G. di Prisco et al., Gene 295 (2002): 185–191; E. Cocca et al., Proceedings of the National Academy of Sciences, USA 92 (1995): 1817–1823; и Y. Zhao et al., Journal of Biological Chemistry 273 (1998): 14 745–14752. Общему обзору генетики и биологии ледяных рыб посвящена статья B. D. Si dell, Gravitational and Space Biology Bulletin 13 (2000): 25–34. О функциональной эволюции микротрубочек ледяных рыб можно прочесть в статье H. W. Detrich et al., Journal of Biological Chemistry 275 (2000): 37 038–37047. О происхождении антифриза ледяных рыб можно узнать в работе L. Chen, A. L. DeVries, and C.-H. C. Cheng, Proceedings of the National Academy of Sciences, USA 94 (1997): 3811–3816, а о судьбе миоглобина ледяных рыб подробно написано в статьях B. D. Sidell et al., Proceedings of the National Academy of Sciences, USA 94 (1997): 3420–3424; T. J. Moylan and B. D. Sidell, The Journal of Experimental Biology 203 (2000): 1277–1286; и D. J. Small et al., The Journal of Experimental Biology 206 (2003): 131–139.

Геологические особенности антарктического региона и история Южного океана описаны в обзоре J. Zachos et al., Science 292 (2001): 686–693. Об охлаждении океана можно узнать из статьи A. E. Shevenall, J. P. Kennett, and D. W. Lea, Science 305 (2004): 1766–1770. Об истории нототениевых рыб я узнал из статей T. J. Near, Antarctic Science 16(2004):37–44; и T. J. Near,].). Pesavento, and C.-H. C. Cheng, Molecular Phylogenetics and Evolution 32 (2004): 881–891.

Истории путешествий Дарвина, его жизни, замечательным открытиям и трудам посвящено множество книг. Отдельные детали и даты я взял из книги A. Desmond and). Moore, Darwin: The Life of a Tormented Evolutionist (London: Michael Joseph, 1991). Фрагменты из книги «О происхождении видов» (On the Origin of Species) взяты из первого издания 1859 г. Выражение «выживание наиболее приспособленного» (survival of the fittest) впервые появилось в труде философа Герберта Спенсера «Социальная статистика» (1851).

Цитаты из высказываний сэра Питера Медавара я взял из книги J. A. Moore, Science as a Way of Knowing: The Foundation of Modern Biology (Cambridge, Mass.: Harvard University Press, 1993).

Исчерпание запасов антарктического криля описано в статье A. Atkinson et al., Nature 432 (2004): 100–103.

2. Математика эволюции. Вероятность, отбор и время

Профессор Калифорнийского университета Майк Оркин сравнивал вероятность выигрыша в лотерею с вероятностью автомобильной катастрофы или другого несчастного случая в беседе с журналисткой CNN Дейрин Каган 22 августа 2001 г. О вероятности быть укушенным собакой, стать жертвой нападения акулы или пумы Скотт Лейти писал в выпуске газеты San Diego Union-Tribune от 22 февраля 2004 г.

Интерес Дарвина к голубям нашел отражение в его книге The Variation of Animal and Plants Under Domestication (London: John Murray, 1868).

Информацию об Уильяме Касле, Р. Паннетте, Г. Т. Дж. Нортоне, Дж. Б. Холдейне и других я почерпнул из полной истории развития эволюционной генетики, в сжатом виде изложенной Уильямом Б. Провином: The Origins of Theoretical Population Genetics, Chicago: University of Chicago Press, 1971. Среди общих обзоров, посвященных естественному отбору в дикой природе, можно назвать следующие: John A. Endler, Natural Selection in the Wild, Princeton, N. J.: Princeton University Press, 1986; J. G. Kingsolver et al., The American Naturalist 157 (2001): 245–261; и A. P. Hendry and M. T. Kinnison, Evolution 53 (1999): 1637–1653.

Эволюция березовой пяденицы описана в следующих книгах и статьях: M. Majerus, Melanism: Evolution in Action, Oxford: Oxford University Press, 1998; B. S. Grant, Evolution 53 (1999): 980–984; B. S. Grant, D. F. Owen, and C. A. Clarke, Journal of Heredity 87(1996): 351–357; а также). Mallet, Genetics Society News, issue 50: 34–38, и J. Coyne, Nature 396 (1998): 35–36.

О влиянии коэффициента отбора на окраску животных можно прочесть в статье H. Hoekstra, K. E. Drumm, and M. W. Nachman, Evolution 58 (2004): 1329–1341. Результаты долгосрочных исследований охоты соколов-сапсанов на голубей представлены в статье A. Palleroni et al., Nature 434 (2005): 973–974. Результаты долгосрочных исследований эволюции колюшки в озере Лоберг описаны в работе M. A. Bell, W. E. Aguirre, and N. J. Buck, Evolution 58 (2004): 814–824.

О скорости мутирования у млекопитающих можно прочесть в обзоре S. Kumer and S. Subramanian, Proceedings of the National Academy of Sciences, USA 99 (2002): 803–808, а об оценочных значениях скорости мутирования у человека в статье M. W. Nachman and S. L. Crowell, Genetics 154 (2000): 297–304. Выводы о частоте мутаций, определяющих черную окраску мешотчатых прыгунов, полученные на основании оценочных данных для домашних мышей, опубликованы в статье G. Schlager and M. M. Dickie, Mutation Research 11 (1971): 89–96. Число подверженных мутациям сайтов названо в статье M. W. Nachman, H. E. Hoekstra, and S. L. D’Agostino, Proceedings of the National Academy of Sciences, USA 100 (2003): 5268–5273 и в процитированной в этой статье литературе. Математические формулы для оценки времени, необходимого для осуществления эволюционных изменений, взяты из книги Wen-Hsiung Li, Molecular Evolution, Sunderland, Mass.: Sinauer Associates, 1997. Данные о скорости воспроизводства мешотчатых прыгунов я взял из статьи H. E. Hoekstra and M. W. Nachman, University of California Publications in Zoology 2005: 61–81. Влияние миграции и отбора на популяцию мешотчатых прыгунов обсуждается в статье M. W. Nachman, Genetica 123 (2005): 125–136.

На тему скорости эволюции я советую прочесть общий обзор P. D. Gingerich, Science 222 (1983): 159–161.

Среди классических работ Кимуры, посвященных нейтральной теории, можно назвать следующие: M. Kimura, Nature 217 (1968): 624–626; M. Kimura, Proceedings of the National Academy of Sciences, USA 63 (1969): 1181–1188; и M. Kimura, The Neutral Theory of Molecular Evolution, Cambridge: Cambridge University Press, 1983.

3. Бессмертные гены. Бег на месте в погоне за вечностью

Открытия и наблюдения Т. Д. Брока, сделанные в Национальном парке Йеллоустон, описаны в следующих работах: T. D. Brock, Annual Review of Microbiology 49 (1995): 1–28; T. D. Brock, Genetics 145(1997): 1207–1210; и T. D. Brock, Life at High Temperatures, Yellowstone Association for Natural Science, History, and Education, 1994. Основные идеи Карла Воуза по поводу таксономической принадлежности архей изложены в статьях C. R. Woese and G. F. Fox, Proceedings of the National Academy of Sciences, USA 74 (1977): 5088–5090; и C. R. Woese, O. Kandler, and M. L. Wheel, Proceedings of the National Academy of Sciences, USA 87 (1990): 4576–4579.

Сравнению геномных последовательностей сейчас посвящено очень много работ. Представленные в книге результаты взяты из статей E. V. Koonin, Nature Reviews Microbiology 1 (2003): 127–136; K. S. Makarova et al., Genome Research 9 (1999): 608–628; R. L. Tatusov et al., BMC Bioinformatics 4 (2003): 41; G. M. Rubin et al., Science 287 (2000); 2204–2215; K. S. Marakova and E. V. Koonin, Genome Biology 4 (2003): 115; и O. Jaillon et al., Nature 431 (2004): 946–957.

«Бессмертные» белки, обнаруженные во всех группах живых организмов, обсуждаются в работе E. V. Koonin, Nature Reviews Microbiology 1 (2003): 127–136. Информацию о том, что в природе существует около 500 бессмертных белков, я почерпнул из личной беседы с Е. В. Куниным, состоявшейся 2 ноября 2004 г.

Об эволюции эукариот из архей и бактерий можно прочесть в статье M. C. Rivera and J. A. Lake, Nature 431 (2004): 152–155; а дальнейшему обсуждению этой темы посвящены работы W. Martin and T. M. Embley, Nature 431 (2004): 134–136 и A. B. Simonson et al., Proceedings of the National Academy of Sciences, USA 102 (2005): 6608–6613.

Последовательности фактора элонгации 10 взяты из открытой базы данных GenBank. О консервативности последовательности этого фактора в эукариотах и археях рассказывается в статье M. C. Rivera, and J. A. Lake, Science 257 (1992): 74–76.

4. Сделать новое из старого

Роли цветового зрения у приматов посвящен обзор B. C. Regan et al., Proceedings of the Royal Society of London B Biological Sciences 356 (2001): 229–283. Данные о пищевых предпочтениях колобусов, шимпанзе и ревунов я взял из статей N. J. Dominy and P. W. Lucas, Nature 410 (2001): 363–366 и P. W. Lucas et al. Evolution 54 (2003): 2636–2643. О специфических вкусах шимпанзе мне в личной беседе 14 июня 2005 г. рассказал Н. Дж. Домини.

О роли цветового зрения у животных также говорится в статье R. Dalton, Nature 428 (2004): 596–597. Основную информацию о структуре света и механизме цветового зрения можно найти в учебниках по физике и биологии, а также в лекциях, доступных в Интернете. В качестве примера рекомендую учебник N. A. Campbell and J. B. Reece, Biology, 7th ed. (San Francisco: Benjamin Cummings, 2004). Об эволюции и физиологии цветового зрения у человека можно прочесть в статье). Nathans, Neuron 24 (1999): 299–312. О цветовой слепоте у макак я прочел в статье A. Onishi et al., Nature 402 (1999): 139–140.

Построение эволюционного древа гоминидов на основании элементов SINE описано в работе A.-H. Salem et al., Proceedings of the National Academy of Sciences. USA 100 (2003): 12 787–12791.

Классическая работа о роли удвоения генов в эволюции:

S. Ohno, Evolution by Gene Duplication, Berlin and New York: Springer-Verlag, 1970. Можно назвать еще несколько новых работ: M. Lynch and V. Katju, Trends in Genetics 20 (2004): 544–549; J. A. Cotton and R. D. M. Page, Proceedings of the Royal Society B 272 (2005): 277–283; и M. Lynch and]. S. Conery, Science 290 (2000): 1151–1155.

О цветовом зрении у позвоночных написано много. Для общего ознакомления с молекулярной эволюцией опсинов я рекомендую обзор S. Yokoyama, Gene 300 (2002): 69–78. Кроме того, я воспользовался данными, представленными в следующих работах: S. Yokoyama and F. B. Radlwimmer, Genetics 158 (2001): 1697–1710;). J. I. Fasick and P. R. Robinson, Visual Neuroscience 17 (2000): 781–788; J. I. Fasick and P. R. Robinson, Biochemistry 37 (1998): 433–438; S. Yokoyama and N. Taken aka, Molecular Biology and Evolution 21(2004): 2071–2078 и A.]. Hope et al., Proceedings of Biological Science 22 (1997): 155–163. Об общности между коровами и другими жвачными животными и китообразными рассказывается в статьях M. Nikaido, A. P. Rooney, and N. Okada, Proceedings of the National Academy of Sciences, USA 96 (1999): 10 261–10266; и M. Nikaido et al., Proceedings of the National Academy of Sciences, USA 98 (2001): 7384–7389.

О настройке опсинов на восприятие ультрафиолетового света говорится в статьях Y. Shi and S. Yokoyama, Proceedings of the National Academy of Sciences, USA 100 (2003): 8308–8313; S. Yokoyama, F. B. Radlwimmer and N. S. Blow, Proceedings of the National Academy of Sciences, USA 97 (2000): 7366–7371; Y. Shi, F. B. Radlwimmer and S. Yokoyama, Proceedings of the National Academy of Sciences, USA 98 (2001): 11 731–11736; и A. Odeen and O. Hastad, Molecular Biology and Evolution 20 (2003): 855–861.

Статьи о значении восприятия ультрафиолетового света: у зебровой амадины — A. T. D. Bennett et al., Nature 380 (1996): 433–435; у скворцов — A. T. D. Bennett et al., Proceedings of the National Academy of Sciences, USA 94 (1997): 8618–8621; у лазоревки — S. Hunt et al., Proceedings of the Royal Society of London B Biological Science 265 (1998): 451–455; у волнистого попугайчика — S. M. Pearn et al., Proceedings of the Royal Society of London B Biological Science 268 (2000); 2273–2279; у птенцов — V. Jaurdie et al., Nature 431 (2004): 262–263; у различных птиц — R. Dalton, Nature 428 (2004): 596–597. 06 оперении, отражающем ультрафиолетовый свет, рассказывается в работе F. Hausmann et al., Proceedings of the Royal Society of London B Biological Sciences 270 (2003): 61–67; о видах-двойниках — в статье R. Bleiweiss, Proceedings of the National Academy of Sciences, USA 101 (2004): 16 561–16564. О значении восприятия ультрафиолетового света для пустельги написано в статье J. Vlitala et al., Nature 373 (1995): 425–427, а для летучей мыши — в работе Y. Winter,]. Lopez and O. Van Helverson, Nature 425 (2003): 612–614.

Об эволюции панкреатической рибонуклеазы у колобуса сказано в статье J. Zhang, Y.-P. Zhang and H. F. Rosenberg, Nature (Genetics) 30 (2002): 411–415.

5. Ископаемые гены. Обломки прошлой жизни

Открытие латимерии и ее изучение описано в книгах K. S. Thomson, Living Fossil: The Story of the Coelacanth, New York: W. W. Norton, 1991 и S. Weinberg, A Fish Caught in Time: The Search for the Coelacanth, New York: Harper Collins, 2000.

О том, как ген SWS-опсина латимерии стал ископаемым, рассказывается в статье S. Yokoyama et al., Proceedings of the National Academy of Sciences, USA 96 (1999): 6279–6284. Об образовании ископаемых генов коротковолнового опсина у афалины можно прочесть в статье). J. I. Fasick et al., Visual Neuroscience 15 (1998): 643–651, а у других дельфинов и у китов — в работе D. H. Levenson and A. Dizon, Proceedings of the Royal Society of London B Biological Science 270 (2003): 673–679.

Образование ископаемых генов SWS-опсинов у ночных обезьян и галаго описано в работе G. H. Jacobs, M. Neitz and J. Neitz, Proceedings of the Royal Society of London B Biological Science 263 (1996): 705–710; у лори — в статье S. Kawamura and N. Kubotera, Journal of Molecular Evolution 58 (2004): 314–321; у слепого крота — в статье Z. K. David-Gray et al., European Journal of Neuroscience 16 (2002): 1186–1194.

О множестве генов обонятельных рецепторов у мыши говорится в статье X. Zhang et al., Genomics 83 (2004): 802–811. О превращении человеческих генов обонятельных рецепторов в ископаемые гены можно прочесть в работах Y. Nimura and M. Nei, Proceedings of the National Academy of Sciences, USA 100 (2003): 12 235–12240; B. Malnic, P. A. Godfrey and L. R. Buck, Proceedings of the National Academy of Sciences, USA 101 (2004): 2584–2589; и Y. Gilad et al., Public Library of Science Biology 2 (2004): 120–125. Образование ископаемого гена, связанного с восприятием феромонов, описано в работе E. R. Liman and H. Inan, Proceedings of the National Academy of Sciences, USA 100 (2003): 3328–3332.

Исчезновение пути утилизации галактозы у дрожжей описано в работе C. T. Hittinger, A. Rokas and S. B. Carroll, Proceedings of the National Academy of Sciences, USA, 101 (2004): 14 144–14149. Массовое разрушение генов у бактерии, вызывающей проказу, описано в статье S. T. Cole et al., Nature 409 (2001): 1007–1011.

Разрушение генов, ответственных за окраску цветков ипомеи, было продемонстрировано в работе R. A. Zufall and M. D. Rausher, Nature 428 (2004): 847–850. О разрушении человеческого гена MYH16 рассказывается в статье H. Stedman et al., Nature 428 (2004): 415–418; а также G. H. Perry, B. C. Verrelli and A. C. Stone, Molecular Biology and Evolution 22 (2004): 379–382.

6. Deja vu. Как и почему эволюция повторяется

Об открытии полного трихроматического зрения у ревунов можно узнать из статьи G. H. Jacobs et al., Nature 382 (1996): 156–158. Удвоение генов опсинов у ревунов описано в работах D. M. Hunt et al., Vision Research 38 (1998): 3299–3306; и K. S. Dulai et al.. Genome Research 9 (1999): 629–638. Обзор эволюционной истории цветового зрения у приматов:

D. M. Hunt, Biologist 48 (2001): 67–71. О связи между потерей генов обонятельных рецепторов и приобретением цветового зрения говорится в статье Y. Gilad et al., Public Library of Science Biology 2 (2004): 120–125.

Эволюции генов рибонуклеазы у жвачных посвящена статья J. Zhang, Molecular Biology and Evolution 20 (2003): 1310–1317; а повторению эволюции генов рибонуклеазы у обезьян — статья J. Zhang, Y. Zhang and H. F. Rosenberg, Nature Genetics 30 (2002): 411–415. О повторяющейся потере генов галактозного пути у грибов можно прочесть в работе T. Hittinger, A. Rokas and S. B. Carroll, Proceedings of the National Academy of Sciences, USA 101 (2004): 14 144–14149.

О многократной инактивации гена, ответственного за пигментацию мексиканских пещерных рыб, говорится в работе M. E. Protas et al., Nature Genetics (2005): 38:107–111. Повторение эволюции черной окраски у позвоночных животных в результате мутаций гена MC1R описано в обзоре M. E. N. Majerus and N. I. Mundy, Trends in Genetics 19 (2003): 585–588; а среди оригинальных статей на эту тему можно назвать N. I. Mundy et al., Science 303 (2004): 1870–1873; S. M. Doucet et al., Proceedings of the Royal Society of London B Biological Science 271 (2004): 1663–1670; E. B. Rosenblum, H. E. Hoekstra and M. W. Nachman, Evolution 58 (2004): 1794–1808; N. I. Mundy and J. Kelly, American Journal of Physical Anthropology 121 (2003): 67–80; E. Eizirik et al. Current Biology 13 (2003): 448–453; K. Ritland et al., Current Biology 13 (2001): 1468–1472; M. W. Nachman et al., Proceedings of the National Academy of Sciences, USA 100 (2003): 5268–5273 и E. Theron et al., Current Biology 11 (2001): 550–557.

О независимой эволюции антифриза у арктических и антарктических рыб рассказывается в статье L. Chen, A. L. DeVries and C.-H. C. Cheng, Proceedings of the National Academy of Sciences, USA 94 (1997): 3817–3822.

О структуре токсинов, блокирующих калиевые каналы, сообщалось в следующих работах: S. Gasparini, B. Gilquin and A. Menez, Toxicon 43 (2004): 901–908; M. Dauplous et al., The Journal of Biological Chemistry 272 (1997): 4302–4309; S. Gasparini et al., The Journal of Biological Chemistry 273 (1998): 25 393–25403; и K.-J. Shon, The Journal of Biological Chemistry 273 (1998): 33–38.

Последовательности коротковолновых опсинов птиц взяты из базы данных GenBank. Оценка размеров популяции птиц представлена в отчете Одюбоновского общества State of the Birds 2004 за сентябрь — октябрь 2004 г.

Книга Жака Моно, которую я цитирую, называется «Случайность и необходимость» (Chance and Necessity, New York: Vintage, 1971). Более подробно о воспроизведении эволюции на молекулярном и анатомическом уровне можно узнать из книги S. Conway Morris, Life’s Solution: Inevitable Humans in a Lonely Universe, Cambridge: Cambridge University Press, 2003.

7. Наша плоть и кровь. Гонка вооружений, человеческая раса и естественный отбор

История о человеке, который умер, проглотив ядовитого орегонского тритона, подробно описана в статье S. G. Bradley and L. J. Klika, Journal of the American Medical Association 246 (1981): 247. О «гонке вооружений» между тритонами и змеями можно прочесть в статьях S. Geffeney et al., Science 297 (2002): 1336–1339; и B. L. Williams et al., Herpetologica 59 (2003): 155–163.

О жизни У. Ч. Уэллса можно узнать из статьи W. H. G. Armytage, British Medical Journal 6 (1957): 1302. Два общих обзора по поводу теорий, касающихся цвета человеческой кожи, географии и естественного отбора:). Diamond, Nature 435 (2005): 283–284 и N. G. Jablonski, Annual Review of Anthropology 33 (2004): 585–623. Генетические вариации человеческого гена MC1Rw его влияние на цвет кожи и естественный отбор обсуждаются в работах B. K. Rana et al., Genetics 151 (1999): 1547–1557; R. M. Harding et al., American Journal of Human Genetics 66 (2000): 1351–1361; L. Naysmith, Journal of Investigative Dermatology 122 (2004): 423–428; E. Healy et al., Human Molecular Genetics 10 (2001): 2397–2402 и A. R. Rogers et al., Current Anthropology 45 (2004): 105–107.

Узнать из первых рук об открытии Энтони Эллисоном связи между серповидно-клеточной анемией и малярией можно из статей A. C. Allison, Genetics 166 (2004): 1391–1399 и A. C. Alison, Biochemistry and Molecular Biology Education 30 (2002): 279–287. Среди оригинальных статей можно назвать A. C. Allison et al., Anthropological Institute 82 (1952): 55–60; A. C. Allison, British Medical Journal 1 (1954): 290–294 и A. C. Allison, Transactions of the Royal Society for Tropical Medicine and Hygiene 48 (1954): 312–318. Дж. Б. С. Холдейн писал о связи между талассемией и малярией в Proceedings International Congress on Genetics and Heredity 35 (1949): 267–273 (supplement). О множестве мутаций, приводящих к образованию серповидных эритроцитов у жителей Азии и Африки, говорится в статьях D. Labie et al., Human Biology 61 (1989): 479–491; J. Pagnier et al., Proceedings of the National Academy of Sciences, USA 81 (1984): 1771–1773; A. E. Kulozik et al., American Journal of Human Genetics 39 (1986): 239–244; и C. Lapouméroulie et al.. Human Genetics 89 (1992): 333–337.

Общий обзор, посвященный связи малярии и истории человеческого общества: R. Carter and K. N. Mendis, Clinical Microbiology Reviews 15 (2002): 564–594. Роль мутаций гена G6PD в устойчивости к малярии обсуждается в работе L. Luzzotto and R. Notaro, Science 294 (2001): 442–443, а также S. A. Tishkoff et al., Science 293 (2001): 455–462. Невосприимчивость жителей западных областей Африки к Plasmodium vivax отмечается в статье L. H. Miller et at., The New England Journal of Medicine 295 (1976): 302–304. Краткий обзор характера течения малярии и существующих методов лечения можно найти на сайте Центра по контролю заболеваемости www.cdc.gov/malaria/history/. Об относительно недавнем происхождении P. falciparum говорится в статье S. K. Volkman et al., Science 293 (2001): 482–484.

О возможной связи между мутацией кистозного фиброза и устойчивостью к патогенам впервые было заявлено в работах G. B. Pier, M. Grant and T. S. Zaidi, Proceedings of the National Academy of Sciences, USA 94 (1997): 12 088–12093; и G. B. Pier et al., Nature 393 (1998): 79–82. О роли рецептора CCR5 в устойчивости к ВИЧ можно прочесть в статье E. De Silva and M. P. H. Stumpf, FEMS Microbiology Letters 241 (2004): 1–12.

О поиске более дешевых и эффективных противомалярийных препаратов можно прочесть в статье С. Стринберга в журнале USA Today от 28 апреля 2004.

О роли мутаций и отбора в развитии рака, а также о связи развития рака с эволюцией можно узнать из статьи F. Michor, Y. Iwasa, and M. A. Nowak, Nature Reviews Cancer 4 (2004): 197–206. Об устойчивости клеток хронического миелолейкоза к препарату гливек сообщалось в статьях M. E. Gorre et al., Science 293 (2001): 876–880; и C. Rouche-Lestienne and C. Prudhomme, Seminars in Hematology 40 (2003): 80–82 (supplement). О стратегии преодоления лекарственной устойчивости опухолевых клеток рассказывает статья N. P. Shah et al., Science 305 (2004): 399–401.

8. Создание и эволюция сложного

Теория Дарвина об образовании коралловых рифов была изложена в его книге The Structure and Distribution of Coral Reefs (1842). О дискуссии по этому вопросу можно прочесть в книге D. Dobbs, Reef Madness: Charles Darwin, Alexander Agassiz, and the Meaning of Coral, New York: Pantheon, 2005. Информацию о геологических и биологических особенностях Большого Барьерного рифа я почерпнул из материалов, имеющихся на острове Леди Элиот в Австралии.

Обзор об эволюции глаза: L. V. Salvini-Plawen and E. Mayr, Evolutionary Biology 10 (1977): 207–263. Об обнаружении аналогов гена eyeless у позвоночных рассказывается в работе R. Quiring et al., Science 265 (1994): 785–789. О способности гена Pax-6 индуцировать образование тканей глаза говорится в статье G. Halder, P. Callaerts, and W. J. Gehring, Science 267 (1995): 1788–1792. Распределению и функции гена Pax-6 у животных посвящен обзор W. J. Gehringand K. Ikeo, Trends in Genetics 15 (1999): 371–377. Развитие примитивных глаз у нереид описано в статье D. Arendt et al., Development 129 (2002): 1143–1154.

Расчет времени, необходимого для возникновения сложного глаза, сделан в статье D. E. Nilsson and S. Pelger, Proceedings of the Royal Society of London B Biological Science 256 (1994): 53–58. Подробнее о типах глаз, их оптических свойствах и эволюции можно узнать из книги R. Dawkins, Climbing Mount Improbable, New York: W. W. Norton, 1996. Также рекомендую познакомиться со статьями R. Fernald, Current Opinion in Neurobiology 10 (2000): 444–450 и R. Fernald, International journal of Developmental Biology 48 (2004): 701–705.

Исследованию загадки происхождения различных фоторецепторных клеток посвящена статья D. Arendt, International Journal of Developmental Biology 47 (2003): 563–571, а о решении этой задачи можно узнать из статьи D. Arendt et al., Science 306 (2004): 869–871.

Об «инструментальном наборе» генов я подробно писал в книге Endless Forms Most Beautiful, New York: W. W. Norton, 2005. О различии между эволюцией физиологии и формы, а также о различных генетических механизмах, задействованных в этих процессах, можно узнать из статьи S. B. Carroll, Public Library of Science Biology 3 (2005): 1159–1166.

Об эволюции длины шипов трехиглой колюшки и о роли гена Pitxi можно прочесть в работе M. D. Shapiro et al., Nature 428 (2004): 717–723. Эволюции рисунка на крыльях дрозофилы посвящены статьи N. Gompel et al., Nature 433 (2005); 481–487 и B. Prudhomme et at., Nature 440 (2006): 1050–1053.

Смысл дарвиновского термина «хитроумное приспособление» проанализирован в работах R. Moore, BioScience 47 (1997): 107–114; и S.]. Gould, The Structure of Evolutionary Theory, Cambridge, Mass.: Belknap Press, 2002.

9. Видеть и верить

Историю о родильной горячке и вмешательстве Луи Пастера я прочел в книге D. Reynolds, How Pasteur Changed History: The Story of Louis Pasteur and the Pasteur Institute, Bradenton, Fla.: McGuinn and McGuire, 1994 и в статьях C. M. De Costa, Medical Journal of Australia 177 (2002): 668–671; P. Gallon «Decouverte de I’antisepsie et de I’asepsie chirur-gicale», www.char-fr.net/docs/textes/antisepsie.html (от 10/19/03); и C. L. Case, «Handwashing», National Health Museum, www.accessex-cellenge.org/AE/AEC/CC/hand_background.html

Замечательная книга Ричарда Панека называется Seeing and Believing: How the Telescope Opened Our Eyes and Minds to the Heavens, New York: Penguin, 1998. Историю Галилея можно прочесть и во многих других местах, в частности, можно посмотреть работу Д. Линдера The Trial of Galileo (2002) на сайте Университета Миссури в Канзас-Сити http://law2.umkc.edu/faculty/projects/ftrials/galileo/galileo.html

Рассказ В. Н. Сойфера об эпохе Лысенко я прочел в книге Lysenko and the Tragedy of Soviet Science, New Brunswick, N. J.: Rutgers University Press, 1994 (Власть и наука: разгром коммунистами генетики в СССР. М., 2002). Я также использовал книгу Ж. А. Медведева The Rise and Fall of T. D. Lysenko, New York: Columbia University Press, 1969 (Взлет и падение Лысенко. М., 1993) и книгу H. F. Judson, The Eighth Day of Creation: The Makers of the Revolution in Biology, New York: Simon and Schuster, 1979. Записку Ж. Медведева Маршаллу Ниренбергу можно найти в документах Ниренберга в коллекции Национальной медицинской библиотеки (http://profiles.nlm.nih.gov). Краткая история жизни Н. Вавилова взята из статьи J. F. Crow, Genetics 134 (1993): 1–4. О сельскохозяйственных проблемах в СССР можно прочесть в книге R. W. Wheatcraft and S. G. Davies, The Years of Hunger: Soviet Agriculture, 1931–1933, New York: Palgrave Macmillan, 2004: а о влиянии идей Лысенко на развитие сельского хозяйства в Китае я узнал из книги). Beckers, Hungry Ghosts: Mao’s Secret Famine, New York: Henry Holt, 1996.

О том, как хиропрактики боролись с проведением вакцинации, можно узнать из следующих источников: S. Homola, Bonesetting, Chiropractic, and Cultism (1963 г., книга доступна на сайте www.chiro-base.org), а также J. B. Campbell,). W. Busse, and H. S. Injeyan, Pediatrics 105 (2000): 43–50. Результаты опроса канадских студентов по поводу вакцинации представлены в статье J. W. Busse et al., Canadian Medical Association Journal 166 (2002): 1531–1534; см. также J. W. Busse et al., Journal of Manipulative and Physiological Therapeutics 28 (2005): 367–373 и S. M. Barrett, Chiropractors and Immunization, а также те, кого он цитирует, на сайте www.chirobase.org.

Вот три относительно новые книги о неприятии идеи эволюции: E. C. Scott, Evolution vs. Creationism: An Introduction, Westport, Conn.: Greenwood Press, 2004; M. Pigliucci, Denying Evolution: Creationism, Scientism, and the Nature of Science, Sunderland, Mass.; Sinauer Associates, 2002; M. Ruse, The Evolution — Creation Struggle, Cambridge, Mass.: Harvard University Press.

Большой объем информации об отношении к эволюции, позиции различных религиозных групп, утверждения некоторых оппонентов эволюции и критику этих утверждений, а также общие основы эволюционной теории можно найти на сайте Национального центра научного образования (NCSE) www.ncseweb.org. Если вы неравнодушны к вопросу преподавания эволюции в школе, будет правильно, если вы поддержите эту организацию.

Многие данные и цитаты, приведенные в тексте, взяты из документа NCSE Setting the Record Straight: A Response to Creationist Misinformation About the PBS Series Evolution. Этот документ представляет собой ответ на различные критически выступления, в том числе выступление К. Камминга A Review of the PBS Video Series Evolution (Santee, Calif.: Institute for Creation Research, 2004).

Среди примеров креационистской критики теории эволюции и многочисленных заблуждений креационистов H. M. Morris, Science and the Bible, Chicago: Moody Press, 1986; H. M. Morris, The Scientific Case Against Evolution, Impact no. 330 (2000); и P. Fernandes, The Scientific Case Against Evolution (Ph. D. thesis, institute of Biblical Defense, 1997).

О Кене Хэме можно прочесть в статье The ‘Missing’ Link to School Violence, в журнале Creation Magazine от 29 апреля 1999. Статья Кела Томаса о папе римском была опубликована в журнале Los Angeles Times Syndicate 30 октября 1996. Джерри Бергман вспомнил о Гитлере в статье в Creation ex Nihilo Journal 13 (1999): 101–111.

Цитата Стива Джонса взята из его книги Darwin’s Ghost: The Origin of Species Updated, New York: Random House, 1999.

Выступление преподобного Харриса Thought for the Day прозвучало 15 марта 2002, а текст этого выступления можно найти на сайте www.oxford.anglican.org. Другие отзывы на выступления креационистов и различие между теорией и фактом в науке обсуждаются в статье J. Rennie, Scientific American 287 (2002): 78–85.

Книга Майкла Бехе о разумном замысле называется Darwin’s Black Box: The Biochemical Challenge to Evolution, New York: Free Press, 1996. С критикой Кена Миллера можно ознакомиться в статье Creation/Evolution 16 (1996): 36–40. Также можно прочесть главу K. R. Miller, The Flagellum Unspun: The Collapse of Irreducible Complexity в книге Debating Design: From Darwin to DNA, ed. M. Ruse and W.. Dembski, Cambridge; Cambridge University Press, 2004: 81–97, а также статью H. A. Orr, Devolution в журнале The New Yorker от 30 мая 2005.

Историю генов глобинов я изложил в соответствии с данными, представленными в статьях G. Di Prisco et al., Gene 295 (2002): 185–191; R. C. Hardison, Proceedings of the National Academy of Sciences, USA 98 (2001): 1327–1329; N. Gillemans et al., Blood 101 (2003): 2842–2849; и R. Hardison, Journal of Experimental Biology 201 (1998): 1099–1117.

О решении судьи Джонса можно узнать из материалов дела 04CV2688, United States District Court for the Middle District of Pennsylvania. Текст письма, подписанного священниками из Висконсина и других штатов, можно найти на сайте www.uwash.edu/colleges/cols/religion_science-collaboration.htm.

10. Пальмы Вайоминга

История строительства трансконтинентальной железной дороги и великолепие американского запада описаны в книге H. T. Williams, The Pacific Tourist: Williams Illustrated Guide to Pacific RR, California and Pleasure Resorts Across the Continent, New York: Henry T. Williams, 1876.

О том, как были обнаружены окаменелые рыбы, о геологии и ископаемых животных региона Фоссил-Бьютт можно прочесть в работе P. O. McGrew and M. Casiliano, The Geologic History of Fossil Butte National Monument and Fossil Basin, National Park Service Occasional Paper 3. Дополнительную информацию об этом памятнике вы найдете на сайте www.nps.gov/fobu. Об индивидуальных экскурсиях и коллекции Ульриха сообщается на сайте www.ulrichsfos-silgallery.com.

Эволюционные последствия охоты на снежных баранов описаны в статье D. W. Coltman et al., Nature 426 (2003): 655–658.

О значении трески для освоения океанских просторов и развития мировой торговли рассказано в книге M. Kurlansky, Cod: A Biography of the Fish That Changed the World, New York: Walker, 1997. Об исчезновении трески в Северной Атлантике говорится в статье E. Brubaker, Political Environmentalism, ed. T. Anderson, Stanford, Calif.: Hoover Institution Press, 2000:161–210. О влиянии избыточного лова на эволюцию трески можно прочесть в статьях E. M. Olsen et al., Nature 428 (2004): 932–935 и). A. Hutchings, Nature 428 (2004): 899–900. Последствия исчезновения рыбы для населения, традиционно занимавшегося рыболовством, описаны в статье T. Bartelme в журнале The Post and Carrier (Чарльстон, Южная Каролина) от 23 июня 1996 г. Об адаптационных изменениях рыб в условиях отлова наиболее крупных особей сказано в статье M. R. Walsh et al., Ecology Letters (2006): 142–148.

Об общем сокращении численности крупных рыб сообщалось в работах R. A. Myers and B. Worm, Nature 423 (2003): 280–283 и R. A. Myers and B. Worm, Proceedings of the Royal Society of London B Biological Science 360 (2005): 13–20. Количественные данные взяты из интервью Майерса и Уорма, опубликованного в журнале National Geographic News 15 мая 2003 г.

Об исчезновении острорылых скатов рассказано в статье J. M. Casey and R. A. Myers, Science 281 (1998): 690–692. О снижении численности акул можно прочесть в работе). K. Bauer et al., Science 299 (2003): 389–392.

О роли избыточного лова в разрушении экосистем шельфовой зоны можно прочесть в статье J. B. C. Jackson et al., Science 293 (2001): 629–638. Анализ разрушения коралловых рифов проведен в статье J. H. Pandolfi et al., Science 301 (2003): 955–958.

О плачевном состоянии Чесапикского залива сообщалось в отчете за 2004 г., Annapolis, Md.: Chesapeake Bay Foundation, 2004. О глобальном влиянии климатических изменений говорится в отчете C. Parmesan and H. Galbraith Observed Impacts of Global Climate Change in the U. S., Pew Center on Global Climate Change, ноябрь 2004. О влиянии климатических изменений на улов некоторых видов морских животных сообщается в статье A. L. Perry et al., Science 308 (2005): 1912–1915. О роли отбора в поддержании устойчивого рыболовства говорится в работе D. O. Conover and S. B. Munch, Science 297 (2002): 94–96.

О численности китов до начала промышленного китобойного промысла сообщалось в статье J. Roman and S. Palumbi, Science 301 (2003): 508–510. Информацию об истории китобойного промысла я взял из отчетов Международной комиссии и из истории Антарктики, доступных на сайте www.antarcticonline.com. О сокращении численности популяции криля сказано в статье A. Atkinson et al., Nature 432 (2004): 100–103. Изменение температуры воздуха и воды в антарктическом регионе обсуждается в отчете Британской антарктической службы в газете The Guardian за 10 сентября 2002 г. Быстрое сокращение численности популяции ледяных рыб отмечено в обзоре Review of the State of the World Fishery Resources: Marine Fisheries, FAO Fisheries Circular No. 920 (Rome: Marine Resource Service, Fishery Resource Division, Fisheries Department, Food and Agriculture Organization, 1997).

Благодарности

Когда мне было 12 или 13 лет, мой дядя, назовем его дядя Дик, спросил меня, кем я хочу стать, когда вырасту. «Биологом», — выпалил я. Дядя Дик наморщил свой необыкновенно большой лоб и пробурчал: «Но за это ведь не платят денег».

К счастью, наши родители рассматривали вопрос о выборе профессии в не столь практическом ключе и позволили своим четверым детям заниматься тем, что им нравилось. Потом я узнал, что родители многих счастливых людей придерживались такой же точки зрения. Поэтому я благодарю маму и папу за то, что они разрешали мне держать дома змей, тритонов, саламандр и ящериц, а их извивающуюся, отвратительного вида пищу хранить в нашем холодильнике.

Но теперь груз проблем, связанных с моими необычными интересами, пал на плечи моей собственной семьи. Без помощи, поддержки, любви и чувства юмора моих домочадцев я не смог бы осуществить намеченного. Моя жена Джейми не просто терпеливо переносит увлечения мужа: она подыскивала и создавала иллюстрации к этой книге и очень много времени потратила на то, чтобы текст стал доступным для восприятия. Мои сыновья Уилл и Патрик сопровождали меня в поездках по удивительным местам, о которых я пишу в этой книге, таким как Йеллоустонский национальный парк или национальный памятник Фоссил-Бьютт. Перекличка моего пасынка Криса с обезьянами ревунами на Коста-Рике послужила толчком к созданию шестой главы книги.

Я также благодарен моим братьям и сестре, которые всегда поддерживали меня во всех начинаниях. Питер и Джим помогли оформить пару глав книги, а Нэнси участвовала в затянувшейся на десятилетие дискуссии об истории возникновения эволюционной биологии.

Я очень признателен моим коллегам из Висконсинского университета в Мэдисоне за творческое и критическое обсуждение рукописи. Лианн Олдс создала или адаптировала почти все рисунки для книги, профессор Джеймс Ф. Кроу, а Энтонис Рокас, Бенжамин Прюдомм, Стив Пэддок и Крис Хиттингер прочли рукопись целиком и внесли много ценных замечаний и предложений.

Описанные в книге открытия являются плодом творческой деятельности и тяжелого труда тысяч ученых, участвовавших в создании методов анализа ДНК, генов и геномов многих видов организмов. Я благодарю всех исследователей, предоставивших мне свои иллюстрации и поделившихся со мной своими наблюдениями и идеями. Особую благодарность я выражаю Майклу Нахману, Майклу Линчу, Клиффу Табину и Евгению Кунину за подробное обсуждение и полезную информацию.

Я также хочу выразить свою признательность тем людям, которые сотрудничают со мной на протяжении последних 20 лет. Я по-прежнему получаю больше знаний от своих студентов и аспирантов, чем передаю им сам. Благодаря трудолюбию и увлеченности сотрудников наша исследовательская лаборатория стала местом, где с удовольствием проводишь каждый день. А мои ближайшие коллеги в разных странах мира являются для меня постоянным источником вдохновения и информации. Необычайную свободу творчества я смог почувствовать благодаря щедрой финансовой поддержке Медицинского института Говарда Хьюза.

Я выражаю особую благодарность моему агенту Расселу Галену, который помог мне сформулировать основную концепцию книги и всячески поддерживал меня в ходе работы, а также моему издателю Джеку Репчеку за его неиссякаемый энтузиазм, критический взгляд и уверенность в том, что эта книга важна и полезна.

Источники иллюстраций в цветной вкладке

H, I © Australian Museum

J, K © 2004 National Academy of Sciences, USA

L © Paul Bratescu

Примечания

1

Уильям Бэтсон (1861–1926) — английский биолог, один из основателей генетики; речь идет о его книге Materials for the study of variation (1894). — Прим. перев.

(обратно)

2

Здесь и далее — цит. по: Дарвин Ч. Происхождение видов путем естественного отбора. Перевод с шестого английского издания К. А. Тимирязева, М. А. Мензибра, А. П. Павлова и И. А. Петровского. М., 2003. — Прим. ред.

(обратно)

3

В русском издании соответствует гл. XIV. — Прим. ред.

(обратно)

4

В русском издании этот фрагмент отсутствует. — Прим. ред.

(обратно)

5

Альфред Рассел Уоллес (1823–1913) — знаменитый британский путешественник, биолог и антрополог. — Прим. перев.

(обратно)

6

«Один длинный аргумент: Чарльз Дарвин и генезис современной эволюционной теории» (One Long Argument: Charles Darwin and the Genesis of Modern Evolutionary Thought. Cambridge, 1991) — книга известного дарвиниста Эрнста Майра. — Прим. перев.

(обратно)

7

Чарльз Лайель (1797–1875) — крупнейший шотландский ученый, основоположник современной геологии. — Прим. перев.

(обратно)

8

В русском издании соответствует гл. XV. — Прим. ред.

(обратно)

9

Питер Медавар (1915–1987) — британский зоолог и иммунолог. — Прим. перев.

(обратно)

10

Лаборатория Джексона — независимая некоммерческая организация, занимающаяся биомедицинскими исследованиями; образована в 1929 году и названа в честь Р. Б. Джексона, оказавшего большую финансовую поддержку при ее создании. — Прим. перев.

(обратно)

11

Линн Маргулис (1938–2011) — американский микробиолог, основатель современной версии теории симбиогенеза. — Прим. перев.

(обратно)

12

Около 57 кг. — Прим. перев.

(обратно)

13

Река Чалумна. — Прим. перев.

(обратно)

14

Для русскоязычного читателя в этом задании нет ничего сложного, поскольку этот микроорганизм назван в честь советского микробиолога Владимира Ильича Кудрявцева (1900–1999). — Прим. перев.

(обратно)

15

Для простоты я оперирую не формальной вероятностью, а «средними» значениями. — Прим. авт.

(обратно)

16

Премия Дарвина (Darwin Awards) — виртуальная премия, ежегодно присуждаемая лицам, которые наиболее глупым способом умерли или потеряли способность иметь детей и тем самым улучшили генофонд человечества, лишив его своих генов. — Прим. перев.

(обратно)

17

Полное название фермента — глюкозо-6-фосфатдегидрогеназа. — Прим. перев.

(обратно)

18

Подробнее я рассказываю об этих открытиях и их значении в моей новой книге «Бесконечное число самых прекрасных форм. Новая наука эво-дево» (Endless Forms Most Beautiful: The New Science of Evo Devo). — Прим. авт.

(обратно)

19

Автор читал книгу в американском издании: Lysenko and the Tragedy of Soviet Science, New Brunswick, N. J.: Rutgers University Press, 1994. — Прим. ред.

(обратно)

20

Эти слова принадлежат наркому земледелия Я. А. Яковлеву. — Прим. перев.

(обратно)

21

Вавилов не получил разрешения на выезд, и председательское кресло осталось пустым. — Прим. перев.

(обратно)

22

Высшая мера наказания была заменена 20 годами лишения свободы в исправительно-трудовых лагерях. — Прим. перев.

(обратно)

23

Речь идет об Институте молекулярной биологии в Москве, который был основан академиком В. А. Энгельгардтом и который теперь носит его имя. — Прим перев.

(обратно)

24

Маршалл Ниренберг (1927–2010) — американский биохимик и генетик, получивший в 1968 г. Нобелевскую премию по физиологии и медицине «за расшифровку генетического кода и выяснение его роли в синтезе белков» (совместно с Р. Холли и X. Г. Кораной). — Прим. перев.

(обратно)

25

Здесь неточность: в 1967 году книга Ж. Медведева «Биологическая наука и культ личности» была подготовлена к публикации, но власти запретили ее печатать. В США книга вышла под названием The Rise and Fall of T. D. Lysenko («Взлет и падение Лысенко»). — Прим. ред.

(обратно)

26

Джон Келвин «Кел» Томас — американский журналист и политический комментатор, христианин-евангелист. — Прим. перев.

(обратно)

27

Джерри Бергман — американский биолог, писатель, активный сторонник креационизма. — Прим. перев.

(обратно)

28

Примерно 83,5 м2. — Прим. перев.

(обратно)

29

По другой версии, впервые этот мыс в 1524 г. открыл флорентиец Джованни да Верраццано, который и назвал его Паллавичино (в честь одного из древних итальянских родов), а англичанин Госнольд переименовал его в Кейп-Код, что буквально означает «мыс трески». — Прим. перев.

(обратно)

Оглавление

  • Предисловие Вне всяких сомнений
  • Глава 1 Введение. Белокровная рыба с острова Буве
  •   Возвращаемся к Дарвину
  •   Покажите нам этапы эволюции
  •   Следы эволюции в ДНК
  •   Видеть и верить: почему эволюция так важна
  • Глава 2 Математика эволюции. Вероятность, отбор и время
  •   Преодолеваем сомнения с помощью голубей и крыс
  •   Алгебра эволюции
  •   Естественный отбор в дикой природе
  •   Лотерея мутаций: все мы мутанты
  •   Время
  •   Летопись ДНК: отслеживаем этапы эволюции
  • Глава 3 Бессмертные гены. Бег на месте в погоне за вечностью
  •   Изучаем ДНК и читаем генетический код
  •   Судьбы генов. Бессмертное ядро
  •   Бег на месте: консервативность естественного отбора
  •   Появление эукариот: союз двух непохожих родителей?
  • Глава 4 Сделать новое из старого
  •   Рассматриваем радугу
  •   От молекул к деревьям
  •   Запутанная история возникновения цветового зрения
  •   Красное и зеленое
  •   В глубоком синем море
  •   За пределами радуги
  •   Жвачные обезьяны
  •   Изобретаем и адаптируемся
  • Глава 5 Ископаемые гены. Осколки прошлой жизни
  •   Смена места жительства и ископаемые гены опсинов
  •   Жизнь в темноте
  •   Не чувствуете, чем пахнет?
  •   Используй, или потеряешь
  •   Причина или следствие?
  •   Ископаемые гены как аргумент против «прогресса» и «замысла»
  • Глава 6 Deja vu. Как и почему эволюция повторяется
  •   Второе пришествие трихроматических обезьян
  •   Одним путем к одной цели
  •   Разными путями к одной цели
  •   Вероятность, необходимость и (вос)создание наиболее приспособленного
  •   Случайность: «идентичные или эквивалентные мутации случайным образом возникают снова и снова»
  •   Отбор: «их судьба зависит от действия отбора на тот признак, на который эти мутации влияют»
  • Глава 7 Наша плоть и кровь. Гонка вооружений, человеческая раса и естественный отбор
  •   Человек против солнца
  •   Бактериологическая война
  •   Внутренние враги
  •   Естественный отбор: абсолютная необходимость
  • Глава 8 Создание и эволюция сложного
  •   Внешность обманчива: у всех животных один и тот же набор генов для построения тела и органов
  •   Биоразнообразие — результат использования одинаковых генов разными способами
  •   Бесконечное число самых прекрасных мушек
  •   Создаем сложное
  • Глава 9 Видеть и верить
  •   Комиссар советской биологии
  •     Генетика как буржуазная наука
  •     Аресты и расстрелы
  •     Отрицание ДНК
  •   Костоломы
  •   Отрицание эволюции
  •   Старое вино в новой бутылке: миф о разумном замысле
  •   Почему эволюция так важна?
  • Глава 10 Пальмы Вайоминга
  •   Неестественный отбор
  •   Мыс без трески
  •   Куда исчезла крупная рыба?
  •   Эффект домино
  •   Идеальный шторм
  •   Возвращаемся на остров Буве
  •   Бьем в набат
  • Источники и дополнительная литература
  • Благодарности
  • Источники иллюстраций в цветной вкладке